Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-30a-3p URS0000065D58_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-30a: Ssc-mir-30a is a small RNA that is generated from the loop or the region between the loop and stem [PMC4008308]. It is one of the miRNAs that can be generated from miRNA-offset RNAs (moRNAs) [PMC4001129]. In a study involving castrated and intact male pigs, ssc-mir-30a was one of the eight miRNAs that were validated [PMC3901342]. The expression levels of ssc-mir-30a were found to be lower in intact male pigs compared to castrated male pigs [PMC3901342]. Ssc-mir-30a, along with ssc-miR-30e, was found to target the AR gene in this study [PMC3901342].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUUUCAGUCGGAUGUUUGCAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 28 other species

  1. Alligator mississippiensis ami-miR-30a-3p
  2. Anolis carolinensis aca-miR-30a-3p
  3. Cavia porcellus (domestic guinea pig) cpo-miR-30a-3p
  4. Chrysemys picta cpi-miR-30a-3p
  5. Columba livia (rock pigeon) cli-miR-30e-3p
  6. Cricetulus griseus (Chinese hamster) cgr-miR-30a-3p
  7. Danio rerio (zebrafish) dre-miR-30e-3p
  8. Dasypus novemcinctus dno-miR-30a-3p
  9. Gallus gallus gga-miR-30a-3p
  10. Gorilla gorilla gorilla ggo-miR-30a-3p (MIR30A)
  11. Gorilla gorilla ggo-miR-30a-3p
  12. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-30a-3p
  13. Homo sapiens (human) hsa-miR-30a-3p
  14. Ictalurus punctatus (channel catfish) ipu-miR-30e
  15. Macaca mulatta (Rhesus monkey) mml-miR-30a-3p
  16. Mus musculus mmu-miR-30a-3p
  17. Ophiophagus hannah (king cobra) oha-miR-30a-3p
  18. Ornithorhynchus anatinus oan-miR-30a-3p
  19. Oryctolagus cuniculus ocu-miR-30a-3p
  20. Pan paniscus ppa-miR-30a-3p
  21. Pan troglodytes ptr-miR-30a-3p
  22. Pongo pygmaeus ppy-miR-30a-3p
  23. Python bivittatus pbv-miR-30a-3p
  24. Rattus norvegicus (Norway rat) rno-miR-30a-3p
  25. Salmo salar (Atlantic salmon) ssa-miR-30d-3p
  26. Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-30-P1b_3p (mature (guide))
  27. Tor tambroides miR-30e-3p
  28. Tursiops truncatus miR-30a-3p
Publications