Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-30e-3p URS0000065D58_7955

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Danio rerio. Annotated by 3 databases (miRBase, ENA, RefSeq). Described in 15 papers. Danio rerio (zebrafish) dre-miR-30e-3p sequence is a product of dre-miR-30e-3p, dre-miR-30e, miR-30e-3p, miR-30e, miR-30, mir30e-2 genes. Found in the zebrafish reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CUUUCAGUCGGAUGUUUGCAGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 181 other species

    1. Alligator mississippiensis (American alligator) ami-miR-30a-3p
    2. Anolis carolinensis (green anole) aca-miR-30a-3p
    3. Bos taurus (cattle) Bta-Mir-30-P1a_3p* (star (passenger))
    4. Canis lupus familiaris Cfa-Mir-30-P1a_3p* (star (passenger))
    5. Cavia porcellus cpo-miR-30a-3p
    6. Chrysemys picta bellii Cpi-Mir-30-P1a_3p* (star (passenger))
    7. Chrysemys picta (Painted turtle) cpi-miR-30a-3p
    8. Columba livia cli-miR-30a-3p
    9. Cricetulus griseus cgr-miR-30a-3p
    10. Dasypus novemcinctus (nine-banded armadillo) dno-miR-30a-3p
    11. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-30-P1a_3p* (star (passenger))
    12. Gallus gallus (chicken) gga-miR-30a-3p
    13. Gorilla gorilla ggo-miR-30a-3p
    14. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-30a-3p
    15. Homo sapiens (human) hsa-miR-30a-3p
    16. Ictalurus punctatus (channel catfish) ipu-miR-30e
    17. Macaca mulatta mml-miR-30a-3p
    18. Monodelphis domestica Mdo-Mir-30-P1a_3p* (star (passenger))
    19. Mus musculus mmu-miR-30a-3p
    20. Ophiophagus hannah oha-miR-30a-3p
    21. Ornithorhynchus anatinus oan-miR-30a-3p
    22. Oryctolagus cuniculus (rabbit) ocu-miR-30a-3p
    23. Pan paniscus (pygmy chimpanzee) ppa-miR-30a-3p
    24. Pan troglodytes ptr-miR-30a-3p
    25. Pongo pygmaeus (Bornean orangutan) ppy-miR-30a-3p
    26. Python bivittatus (Burmese python) pbv-miR-30a-3p
    27. Rattus norvegicus rno-miR-30a-3p
    28. Salmo salar (Atlantic salmon) ssa-miR-30d-3p
    29. Sarcophilus harrisii Sha-Mir-30-P1a_3p* (star (passenger))
    30. Sus scrofa ssc-miR-30a-3p
    31. Taeniopygia guttata (zebra finch) Tgu-Mir-30-P1a_3p* (star (passenger))
    32. Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-30-P1b_3p (mature (guide))
    33. Tor tambroides miR-30e-3p
    34. Tursiops truncatus miR-30a-3p
    Publications New