Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-495 URS000005A8ED_9913

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Bos taurus. Annotated by 3 databases (miRBase, RefSeq, MirGeneDB). Described in 6 papers. Bos taurus (cattle) bta-miR-495 sequence is a product of bta-miR-495, MIR495, miR-495 genes. Found in the cattle reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AAACAAACAUGGUGCACUUCUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 16 other species

    1. Callithrix jacchus cja-miR-495
    2. Canis lupus familiaris cfa-miR-495
    3. Capra hircus chi-miR-495-3p
    4. Cavia porcellus (domestic guinea pig) cpo-miR-495-3p
    5. Dasypus novemcinctus dno-miR-495-3p
    6. Echinops telfairi Ete-Mir-154-P19_3p (mature (guide))
    7. Equus caballus (horse) eca-miR-495
    8. Homo sapiens (human) hsa-miR-495-3p
    9. Macaca mulatta mml-miR-495-3p
    10. Mus musculus (house mouse) mmu-miR-495-3p
    11. Oryctolagus cuniculus (rabbit) ocu-miR-495-3p
    12. Ovis aries oar-miR-495-3p
    13. Pan troglodytes (chimpanzee) ptr-miR-495
    14. Pongo pygmaeus (Bornean orangutan) ppy-miR-495
    15. Pteropus alecto pal-miR-495-3p
    16. Rattus norvegicus (Norway rat) rno-miR-495
    17. Sus scrofa ssc-mir35