Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-495-3p URS000005A8ED_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (PSICQUIC, RefSeq, miRBase, MirGeneDB, MalaCards, TarBase, ENA, GeneCards). Described in 56 papers. Homo sapiens (human) hsa-miR-495-3p sequence is a product of MIR495, hsa-miR-495-3p, hsa-miR-495, miR-495-3p, hsa-RG-11, RG-11, miR-495 genes. Found in the human reference genome. Interacts with protein-coding genes, including 14-3-3-zeta, 14-3-3GAMMA, 14-3-3γ, 16A, 182-FIP, 39K2, 3D3, 4.1-G, 4.1B, 4.1G.

Interactions 6

According to PSICQUIC, Homo sapiens (human) hsa-miR-495-3p interacts with:

Interaction id Participant Synonyms
URS000005A8ED_9606-2 P08183 P08183
URS000005A8ED_9606-3 P08183 P08183
URS000005A8ED_9606-0 P13500 P13500
URS000005A8ED_9606-4 P13500 P13500
URS000005A8ED_9606-1 Q14119 Q14119
URS000005A8ED_9606-5 Q14119 Q14119

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AAACAAACAUGGUGCACUUCUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 28 other species

    1. Bos taurus (cattle) bta-miR-495
    2. Callithrix jacchus cja-miR-495
    3. Canis lupus familiaris cfa-miR-495
    4. Capra hircus chi-miR-495-3p
    5. Cavia porcellus (domestic guinea pig) cpo-miR-495-3p
    6. Dasypus novemcinctus (nine-banded armadillo) dno-miR-495-3p
    7. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-154-P19_3p (mature (guide))
    8. Equus caballus (horse) eca-miR-495
    9. Macaca mulatta mml-miR-495-3p
    10. Mus musculus (house mouse) mmu-miR-495-3p
    11. Oryctolagus cuniculus (rabbit) ocu-miR-495-3p
    12. Ovis aries oar-miR-495-3p
    13. Pan troglodytes (chimpanzee) ptr-miR-495
    14. Pongo pygmaeus ppy-miR-495
    15. Pteropus alecto pal-miR-495-3p
    16. Rattus norvegicus rno-miR-495
    17. Sus scrofa ssc-mir35