Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Strongylocentrotus purpuratus spu-miR-137 URS000001B36D_7668

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Strongylocentrotus purpuratus. Annotated by 2 databases (RefSeq, miRBase). Strongylocentrotus purpuratus spu-miR-137 sequence is a product of spu-miR-137, miR-137, Mir137 genes. Found in the Strongylocentrotus purpuratus reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UAUUGCUUGAGAAUACACGUAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 23 other species

    1. Acyrthosiphon pisum api-miR-137
    2. Aedes aegypti (yellow fever mosquito) aae-miR-137
    3. Anopheles gambiae aga-miR-137
    4. Bactrocera dorsalis bdo-miR-137
    5. Blattella germanica (German cockroach) Bge-Mir-137-P14-v2_3p (mature (guide))
    6. Capitella teleta cte-miR-137
    7. Culex quinquefasciatus cqu-miR-137
    8. Drosophila ananassae Dan-Mir-137_3p (mature (guide))
    9. Drosophila melanogaster dme-miR-137-3p
    10. Drosophila mojavensis Dmo-Mir-137_3p (mature (guide))
    11. Drosophila pseudoobscura dps-miR-137-3p
    12. Drosophila pseudoobscura pseudoobscura miRNA FBtr0330769_df_nrg
    13. Drosophila simulans dsi-miR-137-3p
    14. Drosophila virilis dvi-miR-137-3p
    15. Drosophila yakuba Dya-Mir-137_3p (mature (guide))
    16. Eisenia fetida (common brandling worm) Efe-Mir-137-P5_3p (mature (guide))
    17. Lingula anatina Lan-Mir-137_3p (mature (guide))
    18. Lytechinus variegatus lva-miR-137-3p
    19. Manduca sexta mse-miR-137
    20. Patiria miniata pmi-miR-137-3p
    21. Ptychodera flava Pfl-Mir-137-v1_3p (mature (guide))
    22. Saccoglossus kowalevskii sko-miR-137
    23. Tribolium castaneum Tca-Mir-137-v2_3p (mature (guide))
    Publications