Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Eisenia fetida (common brandling worm) Efe-Mir-137-P5_3p (mature (guide)) URS000001B36D_6396

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAUUGCUUGAGAAUACACGUAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 23 other species

  1. Acyrthosiphon pisum (pea aphid) api-miR-137
  2. Aedes aegypti (yellow fever mosquito) aae-miR-137
  3. Anopheles gambiae aga-miR-137
  4. Bactrocera dorsalis (oriental fruit fly) bdo-miR-137
  5. Blattella germanica (German cockroach) Bge-Mir-137-P14-v2_3p (mature (guide))
  6. Capitella teleta cte-miR-137
  7. Culex quinquefasciatus cqu-miR-137
  8. Drosophila ananassae Dan-Mir-137_3p (mature (guide))
  9. Drosophila melanogaster dme-miR-137-3p
  10. Drosophila mojavensis Dmo-Mir-137_3p (mature (guide))
  11. Drosophila pseudoobscura dps-miR-137-3p
  12. Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0330769_df_nrg
  13. Drosophila simulans dsi-miR-137-3p
  14. Drosophila virilis dvi-miR-137-3p
  15. Drosophila yakuba Dya-Mir-137_3p (mature (guide))
  16. Lingula anatina Lan-Mir-137_3p (mature (guide))
  17. Lytechinus variegatus (green sea urchin) lva-miR-137-3p
  18. Manduca sexta (tobacco hornworm) mse-miR-137
  19. Patiria miniata (sea bat) pmi-miR-137-3p
  20. Ptychodera flava Pfl-Mir-137-v1_3p (mature (guide))
  21. Saccoglossus kowalevskii sko-miR-137
  22. Strongylocentrotus purpuratus (purple sea urchin) spu-miR-137
  23. Tribolium castaneum (red flour beetle) Tca-Mir-137-v2_3p (mature (guide))