v26

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Capitella teleta cte-miR-137 secondary structure diagram

Capitella teleta cte-miR-137 URS000001B36D_283909

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UAUUGCUUGAGAAUACACGUAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 25 other species

  1. Acyrthosiphon pisum (pea aphid) api-miR-137
  2. Aedes aegypti (yellow fever mosquito) aae-miR-137
  3. Anopheles gambiae (African malaria mosquito) aga-miR-137
  4. Bactrocera dorsalis (oriental fruit fly) bdo-miR-137
  5. Blattella germanica (German cockroach) Bge-Mir-137-P14-v2_3p (mature (guide))
  6. Culex quinquefasciatus (southern house mosquito) cqu-miR-137
  7. Dimorphilus gyrociliatus Dgr-Mir-137_3p (mature (guide))
  8. Drosophila ananassae Dan-Mir-137_3p (mature (guide))
  9. Drosophila melanogaster (fruit fly) dme-miR-137-3p
  10. Drosophila mojavensis Dmo-Mir-137_3p (mature (guide))
  11. Drosophila pseudoobscura dps-miR-137-3p
  12. Drosophila pseudoobscura pseudoobscura miRNA FBtr0330769_df_nrg
  13. Drosophila simulans dsi-miR-137-3p
  14. Drosophila virilis dvi-miR-137-3p
  15. Drosophila yakuba Dya-Mir-137_3p (mature (guide))
  16. Eisenia fetida Efe-Mir-137-P5_3p (mature (guide))
  17. Glossina pallidipes (tsetse fly) Gpa-Mir-137_3p (mature (guide))
  18. Lingula anatina Lan-Mir-137_3p (mature (guide))
  19. Lytechinus variegatus lva-miR-137-3p
  20. Manduca sexta mse-miR-137
  21. Patiria miniata (webbed star) pmi-miR-137-3p
  22. Platynereis dumerilii (Dumeril's clam worm) Pdu-Mir-137_3p (mature (guide))
  23. Ptychodera flava Pfl-Mir-137-v1_3p (mature (guide))
  24. Saccoglossus kowalevskii sko-miR-137
  25. Strongylocentrotus purpuratus (purple sea urchin) spu-miR-137
  26. Tribolium castaneum Tca-Mir-137-v2_3p (mature (guide))
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...

 Publications