Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila virilis dvi-miR-137-3p secondary structure diagram

Drosophila virilis dvi-miR-137-3p URS000001B36D_7244

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAUUGCUUGAGAAUACACGUAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 25 other species

  1. Acyrthosiphon pisum api-miR-137
  2. Aedes aegypti (yellow fever mosquito) aae-miR-137
  3. Anopheles gambiae aga-miR-137
  4. Bactrocera dorsalis (oriental fruit fly) bdo-miR-137
  5. Blattella germanica (German cockroach) Bge-Mir-137-P14-v2_3p (mature (guide))
  6. Capitella teleta cte-miR-137
  7. Culex quinquefasciatus cqu-miR-137
  8. Dimorphilus gyrociliatus Dgr-Mir-137_3p (mature (guide))
  9. Drosophila ananassae Dan-Mir-137_3p (mature (guide))
  10. Drosophila melanogaster dme-miR-137-3p
  11. Drosophila mojavensis Dmo-Mir-137_3p (mature (guide))
  12. Drosophila pseudoobscura dps-miR-137-3p
  13. Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0330769_df_nrg
  14. Drosophila simulans dsi-miR-137-3p
  15. Drosophila yakuba Dya-Mir-137_3p (mature (guide))
  16. Eisenia fetida (common brandling worm) Efe-Mir-137-P5_3p (mature (guide))
  17. Glossina pallidipes (tsetse fly) Gpa-Mir-137_3p (mature (guide))
  18. Lingula anatina Lan-Mir-137_3p (mature (guide))
  19. Lytechinus variegatus lva-miR-137-3p
  20. Manduca sexta mse-miR-137
  21. Patiria miniata (webbed star) pmi-miR-137-3p
  22. Platynereis dumerilii (Dumeril's clam worm) Pdu-Mir-137_3p (mature (guide))
  23. Ptychodera flava Pfl-Mir-137-v1_3p (mature (guide))
  24. Saccoglossus kowalevskii sko-miR-137
  25. Strongylocentrotus purpuratus (purple sea urchin) spu-miR-137
  26. Tribolium castaneum Tca-Mir-137-v2_3p (mature (guide))
Relationships

Molecular Relationships

2D structure

Loading 2D structure...