Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-183 URS0000394886_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-mir-183: Gga-mir-183 is a microRNA that was examined using reverse transcription quantitative polymerase chain reaction (RT-qPCR) to validate data obtained from RNA-Seq [PMC5983721]. It was found to be co-regulated by circRNA225 and circRNA226, along with six other miRNAs, and regulated 207 mRNAs through ceRNA regulation [PMC9063329]. Gga-mir-183 was not detected in any sample, making it an endogenous negative control [PMC4877990]. In a comparison within the LB strain, gga-mir-183 was found to be downregulated in the LP group [PMC8241840]. The decrease in gga-mir-183 may contribute to an increase in EZR protein levels [PMC3472249]. In CD30hi cells, gga-mir-183 was found to be decreased [PMC3472249]. The sequence of gga-mir-183 was obtained from miRBase [PMC4503353]. In summary, gga-mir-183 is a microRNA that has been studied in various contexts. It has been examined using RT-qPCR and found to be co-regulated by circRNAs and other miRNAs. It has also been used as an endogenous negative control and found to be downregulated in certain conditions. The decrease of gga-mir-183 may have implications for the regulation of EZR protein levels.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAUGGCACUGGUAGAAUUCACUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 33 other species

  1. Bos taurus bta-miR-183
  2. Cervus elaphus (red deer) Cel-miR-183
  3. Ciona intestinalis cin-miR-183-5p
  4. Columba livia (rock pigeon) cli-miR-183-5p
  5. Cyprinus carpio ccr-miR-183
  6. Danio rerio dre-miR-183-5p
  7. Eptatretus burgeri Ebu-Mir-96-P3f_5p (mature (guide))
  8. Gekko japonicus Gja-Mir-96-P3-v1_5p (mature (guide))
  9. Gorilla gorilla gorilla ggo-miR-183 (MIR183)
  10. Gorilla gorilla (western gorilla) ggo-miR-183
  11. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-183
  12. Macaca mulatta mml-miR-183-5p
  13. Macaca nemestrina (pig-tailed macaque) mne-miR-183
  14. Maylandia zebra (zebra mbuna) mze-miR-183
  15. Microcaecilia unicolor Mun-Mir-96-P3-v1_5p (mature (guide))
  16. Monodelphis domestica mdo-miR-183-5p
  17. Mus musculus Mus_musculus piRNA piR-mmu-8206866
  18. Neolamprologus brichardi (lyretail cichlid) nbr-miR-183
  19. Ophiophagus hannah oha-miR-183-5p
  20. Oreochromis niloticus oni-miR-183
  21. Pan paniscus (pygmy chimpanzee) ppa-miR-183
  22. Pan troglodytes (chimpanzee) ptr-miR-183
  23. Petromyzon marinus pma-miR-183-5p
  24. Pundamilia nyererei pny-miR-183
  25. Python bivittatus (Burmese python) pbv-miR-183-5p
  26. Saguinus labiatus sla-miR-183
  27. Sphenodon punctatus (tuatara) Spt-Mir-96-P3_5p (mature (guide))
  28. Sus scrofa (pig) ssc-miR-183
  29. Takifugu rubripes (torafugu) fru-miR-183
  30. Tetraodon nigroviridis tni-miR-183
  31. Tor tambroides miR-183-5p
  32. Xenopus laevis xla-miR-183-5p
  33. Xenopus tropicalis xtr-miR-183
Publications