Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Petromyzon marinus (sea lamprey) pma-miR-183-5p URS0000394886_7757

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAUGGCACUGGUAGAAUUCACUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 33 other species

  1. Bos taurus bta-miR-183
  2. Cervus elaphus (red deer) Cel-miR-183
  3. Ciona intestinalis cin-miR-183-5p
  4. Columba livia (rock pigeon) cli-miR-183-5p
  5. Cyprinus carpio ccr-miR-183
  6. Danio rerio dre-miR-183-5p
  7. Eptatretus burgeri Ebu-Mir-96-P3f_5p (mature (guide))
  8. Gallus gallus gga-miR-183
  9. Gekko japonicus Gja-Mir-96-P3-v1_5p (mature (guide))
  10. Gorilla gorilla gorilla ggo-miR-183 (MIR183)
  11. Gorilla gorilla (western gorilla) ggo-miR-183
  12. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-183
  13. Macaca mulatta mml-miR-183-5p
  14. Macaca nemestrina (pig-tailed macaque) mne-miR-183
  15. Maylandia zebra (zebra mbuna) mze-miR-183
  16. Microcaecilia unicolor Mun-Mir-96-P3-v1_5p (mature (guide))
  17. Monodelphis domestica mdo-miR-183-5p
  18. Mus musculus Mus_musculus piRNA piR-mmu-8206866
  19. Neolamprologus brichardi (lyretail cichlid) nbr-miR-183
  20. Ophiophagus hannah oha-miR-183-5p
  21. Oreochromis niloticus oni-miR-183
  22. Pan paniscus (pygmy chimpanzee) ppa-miR-183
  23. Pan troglodytes (chimpanzee) ptr-miR-183
  24. Pundamilia nyererei pny-miR-183
  25. Python bivittatus (Burmese python) pbv-miR-183-5p
  26. Saguinus labiatus sla-miR-183
  27. Sphenodon punctatus (tuatara) Spt-Mir-96-P3_5p (mature (guide))
  28. Sus scrofa (pig) ssc-miR-183
  29. Takifugu rubripes (torafugu) fru-miR-183
  30. Tetraodon nigroviridis tni-miR-183
  31. Tor tambroides miR-183-5p
  32. Xenopus laevis xla-miR-183-5p
  33. Xenopus tropicalis xtr-miR-183