v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-183-5p URS0000394886_7955

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UAUGGCACUGGUAGAAUUCACUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 33 other species

  1. Bos taurus bta-miR-183
  2. Cervus elaphus (red deer) Cel-miR-183
  3. Ciona intestinalis cin-miR-183-5p
  4. Columba livia (rock pigeon) cli-miR-183-5p
  5. Cyprinus carpio ccr-miR-183
  6. Eptatretus burgeri Ebu-Mir-96-P3f_5p (mature (guide))
  7. Gallus gallus gga-miR-183
  8. Gekko japonicus Gja-Mir-96-P3-v1_5p (mature (guide))
  9. Gorilla gorilla gorilla ggo-miR-183 (MIR183)
  10. Gorilla gorilla (western gorilla) ggo-miR-183
  11. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-183
  12. Macaca mulatta mml-miR-183-5p
  13. Macaca nemestrina (pig-tailed macaque) mne-miR-183
  14. Maylandia zebra (zebra mbuna) mze-miR-183
  15. Microcaecilia unicolor Mun-Mir-96-P3-v1_5p (mature (guide))
  16. Monodelphis domestica mdo-miR-183-5p
  17. Mus musculus Mus_musculus piRNA piR-mmu-8206866
  18. Neolamprologus brichardi (lyretail cichlid) nbr-miR-183
  19. Ophiophagus hannah oha-miR-183-5p
  20. Oreochromis niloticus oni-miR-183
  21. Pan paniscus (pygmy chimpanzee) ppa-miR-183
  22. Pan troglodytes (chimpanzee) ptr-miR-183
  23. Petromyzon marinus pma-miR-183-5p
  24. Pundamilia nyererei pny-miR-183
  25. Python bivittatus (Burmese python) pbv-miR-183-5p
  26. Saguinus labiatus sla-miR-183
  27. Sphenodon punctatus (tuatara) Spt-Mir-96-P3_5p (mature (guide))
  28. Sus scrofa (pig) ssc-miR-183
  29. Takifugu rubripes (torafugu) fru-miR-183
  30. Tetraodon nigroviridis tni-miR-183
  31. Tor tambroides miR-183-5p
  32. Xenopus laevis xla-miR-183-5p
  33. Xenopus tropicalis xtr-miR-183
 Publications