Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-328 URS00005FDE70_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-328: Bta-mir-328 is a microRNA that has been studied in relation to various aspects of cattle biology. It has been found to have a low ndG value compared to other microRNAs such as bta-miR-223 and lncRNA XR_003033296.1 [PMC8578396]. Bta-mir-328 is evolutionarily close to other microRNAs such as bta-miR-149-5p and bta-miR-185 in cow and wild yak, but distantly related to bta-miR-24-3p and bta-miR-874 [PMC8578396]. It has been shown to bind to three genes involved in a specific pathway [PMC8578396]. Bta-mir-328, along with other microRNAs like bta-miR-24-3p, bta-miR223, and bta-miR185, has been associated with bovine immune response [PMC8578396]. In a study comparing different stages of cattle development, the expression of bta-mir328 was found to be down-regulated in the BS stage compared with the CO stage [PMC9608168]. Bta-mir328 was also found to regulate target genes involved in cell division and growth [PMC9608168]. In another study comparing healthy cows with at-risk cows, several miRNAs including bta-mir328 were downregulated in healthy cows [PMC10000098]. One study identified an intersection between a predicted MRE for bta-mir328 and an annotated 3' UTR variant in SFTPA1 gene [PMC6061482]. The role of btmir328 in cattle is not well-studied but its human homolog has been shown to play a role in innate immune defense against Haemophilus influenza through negative regulation of phagocytosis [PMC6061482]. In a study comparing different time points, bta-mir328 was found to have a high betweenness in the downregulated miRNA group [PMC9445238].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGGCCCUCUCUGCCCUUCCGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Callithrix jacchus cja-miR-328
  2. Canis lupus familiaris (dog) cfa-miR-328
  3. Capra hircus (goat) chi-miR-328-3p
  4. Cervus elaphus Cel-miR-328
  5. Cricetulus griseus (Chinese hamster) cgr-miR-328
  6. Equus caballus (horse) eca-miR-328
  7. Homo sapiens hsa-miR-328-3p
  8. Mus musculus mmu-miR-328-3p
  9. Pan paniscus ppa-miR-328
  10. Pan troglodytes ptr-miR-328
  11. Pongo pygmaeus ppy-miR-328
  12. Rattus norvegicus (Norway rat) rno-miR-328a-3p
  13. Sus scrofa ssc-miR-328
  14. Tupaia chinensis (Chinese tree shrew) tch-miR-328
Publications