Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Callithrix jacchus (white-tufted-ear marmoset) cja-miR-328 URS00005FDE70_9483

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGGCCCUCUCUGCCCUUCCGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Bos taurus (cattle) bta-miR-328
  2. Canis lupus familiaris (dog) cfa-miR-328
  3. Capra hircus (goat) chi-miR-328-3p
  4. Cervus elaphus Cel-miR-328
  5. Cricetulus griseus (Chinese hamster) cgr-miR-328
  6. Equus caballus (horse) eca-miR-328
  7. Homo sapiens hsa-miR-328-3p
  8. Mus musculus mmu-miR-328-3p
  9. Pan paniscus ppa-miR-328
  10. Pan troglodytes ptr-miR-328
  11. Pongo pygmaeus ppy-miR-328
  12. Rattus norvegicus (Norway rat) rno-miR-328a-3p
  13. Sus scrofa ssc-miR-328
  14. Tupaia chinensis (Chinese tree shrew) tch-miR-328