Homo sapiens (human) hsa-miR-328-3p URS00005FDE70_9606

• 22 nucleotides
• 7 databases (ENA, GeneCards, LncBase, MalaCards, miRBase, RefSeq, TarBase)
• Found in 14 other species
• 1546 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

mRNA interactions 3 total

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

CUGGCCCUCUCUGCCCUUCCGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

1. Bos taurus (cattle) bta-miR-328
2. Callithrix jacchus cja-miR-328
3. Canis lupus familiaris (dog) cfa-miR-328
4. Capra hircus (goat) chi-miR-328-3p
5. Cervus elaphus Cel-miR-328
6. Cricetulus griseus (Chinese hamster) cgr-miR-328
7. Equus caballus (horse) eca-miR-328
8. Mus musculus mmu-miR-328-3p
9. Pan paniscus ppa-miR-328
10. Pan troglodytes ptr-miR-328
11. Pongo pygmaeus ppy-miR-328
12. Rattus norvegicus (Norway rat) rno-miR-328a-3p
13. Sus scrofa ssc-miR-328
14. Tupaia chinensis (Chinese tree shrew) tch-miR-328

Publications Download

• FASTA
• JSON