Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-328 URS00005FDE70_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-328: Ssc-mir-328 is a microRNA that has been identified in several studies as playing a central role in regulatory networks [PMC8614448]. It has been found to be significantly detected in the balanced diet group [PMC8180175]. Ssc-mir-328 has been shown to have more target genes compared to other miRNAs [PMC9453844]. It is also involved in host protective responses and parasite growth [PMC6354428]. Ssc-mir-328 is one of the miRNAs that regulate the production of pro-inflammatory and anti-inflammatory interleukins (ILs) in response to T. gondii infection [PMC8851844]. It is potentially involved in regulating the chemotaxis of immune cells, including neutrophils, lymphocytes, dendritic cells, endothelial cells, eosinophils, monocytes, and leukocytes [PMC8851844]. In addition, ssc-mir-328 is downregulated at 10 dpi and 50 dpi in B cell activation-related pathways [PMC8851844]. It also potentially regulates IL production and plays a pivotal role in IL-mediated signaling pathways triggered by T. gondii infection [PMC8851844]. Ssc-mir-328 has been found to target LRRC8A gene involved in B cell and T cell development [PMC8225432]. References: [PMC8614448] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8614448/ [PMC8180175] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8180175/ [PMC9453844] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9453844/ [PMC6354428] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6354428/ [PM9530237] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9530237/ [PMC8851844] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8851844/ [PMC8225432] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8225432/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGGCCCUCUCUGCCCUUCCGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Bos taurus (cattle) bta-miR-328
  2. Callithrix jacchus cja-miR-328
  3. Canis lupus familiaris (dog) cfa-miR-328
  4. Capra hircus (goat) chi-miR-328-3p
  5. Cervus elaphus Cel-miR-328
  6. Cricetulus griseus (Chinese hamster) cgr-miR-328
  7. Equus caballus (horse) eca-miR-328
  8. Homo sapiens hsa-miR-328-3p
  9. Mus musculus mmu-miR-328-3p
  10. Pan paniscus ppa-miR-328
  11. Pan troglodytes ptr-miR-328
  12. Pongo pygmaeus ppy-miR-328
  13. Rattus norvegicus (Norway rat) rno-miR-328a-3p
  14. Tupaia chinensis (Chinese tree shrew) tch-miR-328
Publications