Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-143-3p URS00005C2A6D_9606

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (TarBase, IntAct, MirGeneDB, GeneCards, RefSeq, LncBase, miRBase, ENA, PSICQUIC, MalaCards). Described in 82 papers. Homo sapiens (human) hsa-miR-143-3p sequence is a product of miR-143, hsa-miR-143-3p, miR-143-3p, hsa-miR-143, 143, MIR143 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 14-3-3, 182-FIP, 39K2, 42C, 5-HT2A, 82-FIP, A121, A170, A20, A2MR.

Interactions 20

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-143-3p interacts with:

Interaction id Participant Synonyms
EBI-26436263 intact:EBI-20558404 EBI-20558404 ENST00000650285 mrna_igf1r
EBI-26441047 intact:EBI-20558404 EBI-20558404 ENST00000650285 mrna_igf1r
EBI-26436548 intact:EBI-20558404 EBI-20558404 ENST00000650285 mrna_igf1r
EBI-26436530 intact:EBI-20558404 EBI-20558404 ENST00000650285 mrna_igf1r
EBI-25468239 intact:EBI-21014881 EBI-21014881 ENST00000256078 mrna_kras
EBI-25468532 intact:EBI-25468563 EBI-25468563 ENST00000377687 mrna_klf5
EBI-25468540 intact:EBI-25468596 EBI-25468596 ENST00000428726 mrna_cd44
EBI-26365116 intact:EBI-26353056 EBI-26353056 ENST00000402219 mrna_sos1
EBI-26363142 intact:EBI-26353056 EBI-26353056 ENST00000402219 mrna_sos1
EBI-26441795 intact:EBI-26441813 EBI-26441813 ENST00000233813 mrna_igfbp5
URS00005C2A6D_9606-0 P01116 P01116
URS00005C2A6D_9606-5 P01116 P01116
URS00005C2A6D_9606-1 P16070 P16070
URS00005C2A6D_9606-6 P16070 P16070
URS00005C2A6D_9606-2 P52789 P52789
URS00005C2A6D_9606-7 P52789 P52789
URS00005C2A6D_9606-8 Q12809 Q12809
URS00005C2A6D_9606-3 Q12809 Q12809
URS00005C2A6D_9606-4 Q13887 Q13887
URS00005C2A6D_9606-9 Q13887 Q13887

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGAGAUGAAGCACUGUAGCUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 60 other species

    1. Alligator mississippiensis ami-miR-143-3p
    2. Anolis carolinensis aca-miR-143-3p
    3. Bos taurus (cattle) Bta-Mir-143_3p (mature (guide))
    4. Canis lupus familiaris (dog) cfa-miR-143
    5. Cavia porcellus cpo-miR-143-3p
    6. Chiloscyllium plagiosum microRNA cpl-miR-143
    7. Chrysemys picta bellii Cpi-Mir-143_3p (mature (guide))
    8. Chrysemys picta cpi-miR-143-3p
    9. Columba livia cli-miR-143-3p
    10. Cricetulus griseus (Chinese hamster) cgr-miR-143
    11. Danio rerio dre-miR-143
    12. Dasypus novemcinctus (nine-banded armadillo) dno-miR-143-3p
    13. Echinops telfairi Ete-Mir-143_3p (mature (guide))
    14. Equus caballus eca-miR-143
    15. Gallus gallus (chicken) Gga-Mir-143_3p (mature (guide))
    16. Haplochromis burtoni abu-miR-143
    17. Ictalurus punctatus ipu-miR-143
    18. Macaca mulatta mml-miR-143-3p
    19. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-143_3p (mature (guide))
    20. Mus musculus mmu-miR-143-3p
    21. Nomascus leucogenys nle-miR-143
    22. Oreochromis niloticus (Nile tilapia) oni-miR-143
    23. Ornithorhynchus anatinus oan-miR-143-3p
    24. Oryctolagus cuniculus ocu-miR-143-3p
    25. Otolemur garnettii oga-miR-143
    26. Ovis aries (sheep) oar-miR-143
    27. Papio hamadryas pha-miR-143
    28. Pteropus alecto (black flying fox) pal-miR-143-3p
    29. Python bivittatus pbv-miR-143-3p
    30. Rattus norvegicus Rno-Mir-143_3p (mature (guide))
    31. Salmo salar ssa-miR-143-3p
    32. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-143_3p (mature (guide))
    33. Scyliorhinus torazame (cloudy catshark) Sto-Mir-143_3p (mature (guide))
    34. Sus scrofa ssc-miR-143-3p
    35. Tor tambroides miR-143
    36. Tursiops truncatus miR-143
    37. Xenopus laevis xla-miR-143-3p
    38. Xenopus tropicalis Xtr-Mir-143_3p (mature (guide))