Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-143 URS00005C2A6D_9615

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cfa-mir-143: Cfa-mir-143 is a microRNA that plays a role in both the antiviral innate immune response and adaptive immune response [PMC5744135]. It is upregulated during the early stage of infection and then gradually decreases [PMC5744135]. Cfa-mir-143 expression can be stimulated or inhibited using agomir or antagomir, respectively [PMC5744135]. It has been shown that cfa-mir-143 is upregulated in the lungs of dogs infected with CIV H3N2 [PMC5744135]. It has been speculated that cfa-mir-143 directly binds to the 3′-untranslated region (UTR) of the insulin-like growth factor binding protein 5 gene (Igfbp5) [PMC5744135]. The expression of cfa-mir-143 can be assessed using a TaqMan miRNA assay [PMC5744135]. The mimic and inhibitor of cfa-mir-143 were artificially synthesized for experimental purposes [PMC5744135]. The expression of cfa-mir-143 was observed to vary in both in vivo and in vitro during a CIV H3N2 infection time course, suggesting its involvement in virus-induced apoptosis [PMC5744135]. Cfa-mir-143 targets Igfbp5, which plays roles in cellular senescence and aging-associated vascular diseases [PMC5744135]. Upregulation of cfa-mir-143 leads to increased apoptosis through activation of the p53-caspase3 pathway, while downregulation reduces apoptosis [PMC5744135].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGAUGAAGCACUGUAGCUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 47 other species

  1. Alligator mississippiensis (American alligator) ami-miR-143-3p
  2. Anolis carolinensis (green anole) aca-miR-143-3p
  3. Bos taurus Bta-Mir-143_3p (mature (guide))
  4. Callorhinchus milii Cmi-Mir-143_3p (mature (guide))
  5. Cavia porcellus (domestic guinea pig) cpo-miR-143-3p
  6. Chiloscyllium plagiosum microRNA cpl-miR-143
  7. Chrysemys picta bellii Cpi-Mir-143_3p (mature (guide))
  8. Chrysemys picta (Painted turtle) cpi-miR-143-3p
  9. Columba livia (rock pigeon) cli-miR-143-3p
  10. Cricetulus griseus cgr-miR-143
  11. Danio rerio dre-miR-143
  12. Dasypus novemcinctus dno-miR-143-3p
  13. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-143_3p (mature (guide))
  14. Equus caballus (horse) eca-miR-143
  15. Gadus morhua (Atlantic cod) Gmo-Mir-143_3p (mature (guide))
  16. Gallus gallus (chicken) Gga-Mir-143_3p (mature (guide))
  17. Gekko japonicus Gja-Mir-143_3p (mature (guide))
  18. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-143
  19. Homo sapiens hsa-miR-143-3p
  20. Ictalurus punctatus (channel catfish) ipu-miR-143
  21. Latimeria chalumnae Lch-Mir-143_3p (mature (guide))
  22. Lepisosteus oculatus (spotted gar) Loc-Mir-143_3p (mature (guide))
  23. Macaca mulatta mml-miR-143-3p
  24. Microcaecilia unicolor Mun-Mir-143_3p (mature (guide))
  25. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-143_3p (mature (guide))
  26. Monopterus albus (swamp eel) Mal-Mir-143_3p (mature (guide))
  27. Mus musculus (house mouse) mmu-miR-143-3p
  28. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-143
  29. Oreochromis niloticus oni-miR-143
  30. Ornithorhynchus anatinus oan-miR-143-3p
  31. Oryctolagus cuniculus (rabbit) ocu-miR-143-3p
  32. Otolemur garnettii (small-eared galago) oga-miR-143
  33. Ovis aries oar-miR-143
  34. Papio hamadryas pha-miR-143
  35. Pteropus alecto pal-miR-143-3p
  36. Python bivittatus (Burmese python) pbv-miR-143-3p
  37. Rattus norvegicus Rno-Mir-143_3p (mature (guide))
  38. Salmo salar (Atlantic salmon) ssa-miR-143-3p
  39. Sarcophilus harrisii Sha-Mir-143_3p (mature (guide))
  40. Scyliorhinus torazame (cloudy catshark) Sto-Mir-143_3p (mature (guide))
  41. Sphenodon punctatus Spt-Mir-143_3p (mature (guide))
  42. Sus scrofa ssc-miR-143-3p
  43. Taeniopygia guttata Tgu-Mir-143_3p (mature (guide))
  44. Tor tambroides (Thai mahseer) miR-143
  45. Tursiops truncatus miR-143
  46. Xenopus laevis xla-miR-143-3p
  47. Xenopus tropicalis Xtr-Mir-143_3p (mature (guide))
Publications