Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) Rno-Mir-143_3p (mature (guide)) URS00005C2A6D_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-143: rno-mir-143 is a microRNA implicated in the regulation of gene expression in rats, with its activity evidenced by its co-localization with differentially methylated loci (DMLs) that are associated with transcriptional regulators and microRNAs, suggesting a role in both cis- and trans-regulation of the transcriptome [PMC4909610]. Predictive models have identified that rno-mir-143 has binding sites (MBSs) that may regulate the gene Fosl1 at 4 hours post-treatment [PMC3273934]. Additionally, rno-mir-143 is associated with MBSs alongside other microRNAs at the same time point, indicating a potential concerted regulatory effect [PMC3273934]. It is also predicted to target Acot7, which has been observed to be up-regulated, and Baat, which is down-regulated according to transcriptomic data [PMC6377737]. Experimental validation of rno-mir-143's expression involves isolating miRNA from rat adipose tissue and using reverse transcription PCR followed by Taq PCR specific to rno-mir-143 [PMC7555933]. This evidence collectively suggests that rno-mir-143 may play a significant role in post-transcriptional gene regulation during different cellular processes.

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGAUGAAGCACUGUAGCUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 52 other species

  1. Alligator mississippiensis ami-miR-143-3p
  2. Anolis carolinensis aca-miR-143-3p
  3. Bos taurus (domestic cattle) Bta-Mir-143_3p (mature (guide))
  4. Callithrix jacchus (white-tufted-ear marmoset) Cja-Mir-143_3p (mature (guide))
  5. Callorhinchus milii Cmi-Mir-143_3p (mature (guide))
  6. Canis lupus familiaris (dog) cfa-miR-143
  7. Cavia porcellus cpo-miR-143-3p
  8. Chiloscyllium plagiosum microRNA cpl-miR-143
  9. Chrysemys picta bellii Cpi-Mir-143_3p (mature (guide))
  10. Chrysemys picta cpi-miR-143-3p
  11. Columba livia (rock pigeon) cli-miR-143-3p
  12. Cricetulus griseus (Chinese hamster) cgr-miR-143
  13. Danio rerio (zebrafish) dre-miR-143
  14. Dasypus novemcinctus dno-miR-143-3p
  15. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-143_3p (mature (guide))
  16. Equus caballus eca-miR-143
  17. Gadus morhua Gmo-Mir-143_3p (mature (guide))
  18. Gallus gallus Gga-Mir-143_3p (mature (guide))
  19. Gekko japonicus Gja-Mir-143_3p (mature (guide))
  20. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-143
  21. Homo sapiens hsa-miR-143-3p
  22. Ictalurus punctatus (channel catfish) ipu-miR-143
  23. Latimeria chalumnae (coelacanth) Lch-Mir-143_3p (mature (guide))
  24. Lepisosteus oculatus Loc-Mir-143_3p (mature (guide))
  25. Loxodonta africana (African savanna elephant) Laf-Mir-143_3p (mature (guide))
  26. Macaca mulatta (Rhesus monkey) mml-miR-143-3p
  27. Microcaecilia unicolor Mun-Mir-143_3p (mature (guide))
  28. Microcebus murinus (gray mouse lemur) Mmr-Mir-143_3p (mature (guide))
  29. Monodelphis domestica Mdo-Mir-143_3p (mature (guide))
  30. Monopterus albus Mal-Mir-143_3p (mature (guide))
  31. Mus musculus (house mouse) mmu-miR-143-3p
  32. Nomascus leucogenys nle-miR-143
  33. Notamacropus eugenii (tammar wallaby) Neu-Mir-143_3p (mature (guide))
  34. Oreochromis niloticus (Nile tilapia) oni-miR-143
  35. Ornithorhynchus anatinus oan-miR-143-3p
  36. Oryctolagus cuniculus (rabbit) ocu-miR-143-3p
  37. Otolemur garnettii (small-eared galago) oga-miR-143
  38. Ovis aries oar-miR-143
  39. Papio hamadryas pha-miR-143
  40. Pongo abelii (Sumatran orangutan) Pab-Mir-143_3p (mature (guide))
  41. Pteropus alecto (black flying fox) pal-miR-143-3p
  42. Python bivittatus (Burmese python) pbv-miR-143-3p
  43. Salmo salar ssa-miR-143-3p
  44. Sarcophilus harrisii Sha-Mir-143_3p (mature (guide))
  45. Scyliorhinus torazame Sto-Mir-143_3p (mature (guide))
  46. Sphenodon punctatus Spt-Mir-143_3p (mature (guide))
  47. Sus scrofa (pig) ssc-miR-143-3p
  48. Taeniopygia guttata Tgu-Mir-143_3p (mature (guide))
  49. Tor tambroides (Thai mahseer) miR-143
  50. Tursiops truncatus miR-143
  51. Xenopus laevis xla-miR-143-3p
  52. Xenopus tropicalis Xtr-Mir-143_3p (mature (guide))
Relationships

Molecular Relationships