v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ovis aries (sheep) oar-miR-143 URS00005C2A6D_9940

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

oar-mir-143: Oar-mir-143 is a type of miRNA that has been studied in various contexts. It has been found to be significantly down-regulated in unmated musk glands compared to mated musk glands [PMC8710055]. In a mated library, oar-mir-143 was one of the predominately expressed miRNAs [PMC8710055]. Real-time quantitative PCR was used to verify the accuracy of sequencing results, and oar-mir-143 was one of the miRNAs selected for validation [PMC7070426]. In sheep, oar-mir-143 was found to be one of the immune-related miRNAs that were highly expressed [PMC7070426]. Oar-mir-143 and oar-mir-361-3p were identified as miRNAs that target several genes based on predictions [PMC6339376]. Oar-mir-143 has also been shown to play an important role in regulating GnRH release [PMC9222358]. It has been identified as one of the highly expressed miRNAs in sheep hypothalamus and distal pituitary [PMC9222358]. Oar-mir-143 has been found to target genes such as FSHR and TRH, which are involved in follicle formation and GnRH release, respectively [PMC7832859][PMC6974689][PMC7832859][PMC7832859][PMC7832859][PM...

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGAGAUGAAGCACUGUAGCUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 47 other species

  1. Alligator mississippiensis (American alligator) ami-miR-143-3p
  2. Anolis carolinensis (green anole) aca-miR-143-3p
  3. Bos taurus Bta-Mir-143_3p (mature (guide))
  4. Callorhinchus milii Cmi-Mir-143_3p (mature (guide))
  5. Canis lupus familiaris (dog) cfa-miR-143
  6. Cavia porcellus (domestic guinea pig) cpo-miR-143-3p
  7. Chiloscyllium plagiosum microRNA cpl-miR-143
  8. Chrysemys picta bellii Cpi-Mir-143_3p (mature (guide))
  9. Chrysemys picta (Painted turtle) cpi-miR-143-3p
  10. Columba livia (rock pigeon) cli-miR-143-3p
  11. Cricetulus griseus cgr-miR-143
  12. Danio rerio dre-miR-143
  13. Dasypus novemcinctus dno-miR-143-3p
  14. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-143_3p (mature (guide))
  15. Equus caballus (horse) eca-miR-143
  16. Gadus morhua (Atlantic cod) Gmo-Mir-143_3p (mature (guide))
  17. Gallus gallus (chicken) Gga-Mir-143_3p (mature (guide))
  18. Gekko japonicus Gja-Mir-143_3p (mature (guide))
  19. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-143
  20. Homo sapiens hsa-miR-143-3p
  21. Ictalurus punctatus (channel catfish) ipu-miR-143
  22. Latimeria chalumnae Lch-Mir-143_3p (mature (guide))
  23. Lepisosteus oculatus (spotted gar) Loc-Mir-143_3p (mature (guide))
  24. Macaca mulatta mml-miR-143-3p
  25. Microcaecilia unicolor Mun-Mir-143_3p (mature (guide))
  26. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-143_3p (mature (guide))
  27. Monopterus albus (swamp eel) Mal-Mir-143_3p (mature (guide))
  28. Mus musculus (house mouse) mmu-miR-143-3p
  29. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-143
  30. Oreochromis niloticus oni-miR-143
  31. Ornithorhynchus anatinus oan-miR-143-3p
  32. Oryctolagus cuniculus (rabbit) ocu-miR-143-3p
  33. Otolemur garnettii (small-eared galago) oga-miR-143
  34. Papio hamadryas pha-miR-143
  35. Pteropus alecto pal-miR-143-3p
  36. Python bivittatus (Burmese python) pbv-miR-143-3p
  37. Rattus norvegicus Rno-Mir-143_3p (mature (guide))
  38. Salmo salar (Atlantic salmon) ssa-miR-143-3p
  39. Sarcophilus harrisii Sha-Mir-143_3p (mature (guide))
  40. Scyliorhinus torazame (cloudy catshark) Sto-Mir-143_3p (mature (guide))
  41. Sphenodon punctatus Spt-Mir-143_3p (mature (guide))
  42. Sus scrofa ssc-miR-143-3p
  43. Taeniopygia guttata Tgu-Mir-143_3p (mature (guide))
  44. Tor tambroides (Thai mahseer) miR-143
  45. Tursiops truncatus miR-143
  46. Xenopus laevis xla-miR-143-3p
  47. Xenopus tropicalis Xtr-Mir-143_3p (mature (guide))
 Publications