Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-195-5p URS00005B3525_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-195: Rno-mir-195 is a microRNA that has been studied in various contexts. In the infraorbital nerve chronic constriction injury (CCI) rat model, the expression of rno-mir-195 was found to be decreased [PMC8914318]. Mechanical stretching experiments showed that rno-mir-195 was one of the eight dysregulated miRNAs after 4 hours of stretch [PMC5856749]. Rno-mir-195 has also been reported to be involved in selenium deficiency-induced heart failure, along with other miRNAs such as rno-miR-16 and rno-miR-199a-5p [PMC5920094]. In addition, rno-mir-195 was found to be expressed specifically in the rat lung and showed higher expression levels in the lung compared to the spleen [PMC1790902]. Furthermore, a study identified rno-mir-195 as one of the miRNAs expressed specifically in the rat lung [PMC1790902]. Overall, these findings suggest that rno-mir-195 plays a role in various physiological processes and may have implications for understanding diseases such as heart failure.

mRNA interactions 3 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGCAGCACAGAAAUAUUGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Capra hircus (goat) miR-195
  2. Equus caballus (horse) eca-miR-195
  3. Gorilla gorilla gorilla ggo-miR-195 (MIR195)
  4. Gorilla gorilla (western gorilla) ggo-miR-195
  5. Homo sapiens (human) hsa-miR-195-5p
  6. Ictidomys tridecemlineatus (thirteen-lined ground squirrel) miR-195
  7. Macaca mulatta (Rhesus monkey) mml-miR-195-5p
  8. Mus musculus (house mouse) mmu-miR-195a-5p
  9. Ovis aries (sheep) miscellaneous RNA
  10. Pan paniscus ppa-miR-195
  11. Pan troglodytes (chimpanzee) ptr-miR-195
  12. Pongo pygmaeus ppy-miR-195
  13. Sus scrofa (pig) ssc-miR-195
  14. Tursiops truncatus (common bottlenose dolphin) miR-195a
Publications