Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-195 URS00005B3525_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-195: Ssc-mir-195 is a highly expressed microRNA in human pluripotent stem cells (hpiPSCs) and is located in the same genome loci as ssc-miR-497 on chromosome 12 [PMC4934789]. In hpiPSCs, ssc-mir-195, along with other microRNAs such as ssc-miR-106a, ssc-miR-363, ssc-miR-497, ssc-miR-146b, ssc-miR-92b-5p, ssc-miR-20b and ssc-miR-935, were highly expressed compared to mpiPSCs [PMC4934789]. Ssc-mir-195 and other microRNAs such as ssc-miR-20b, ssc-miR-128, and sccmi-R3715p were found to regulate the cell cycle and Neurotrophin signaling pathway through their corresponding target genes [PMC4934789]. Additionally, the P53 signaling pathway was regulated by microRNAs including sccmi-R20b and 497 through targeting specific genes [PMC4934789]. In a study on miRNA expression in pigs' lungs during infection with PRRSV (porcine reproductive and respiratory syndrome virus), it was found that miRNAs including mir195 were significantly down-regulated at 3 to 7 days post-infection compared to 0 days post-infection [PMC5381705]. Furthermore, mir195 has been reported to induce postnatal quiescence of skeletal muscle stem cells [PMC6737989]. These findings highlight the importance of mir195 in various biological processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGCAGCACAGAAAUAUUGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Capra hircus (goat) miR-195
  2. Equus caballus (horse) eca-miR-195
  3. Gorilla gorilla gorilla ggo-miR-195 (MIR195)
  4. Gorilla gorilla (western gorilla) ggo-miR-195
  5. Homo sapiens (human) hsa-miR-195-5p
  6. Ictidomys tridecemlineatus (thirteen-lined ground squirrel) miR-195
  7. Macaca mulatta (Rhesus monkey) mml-miR-195-5p
  8. Mus musculus (house mouse) mmu-miR-195a-5p
  9. Ovis aries (sheep) miscellaneous RNA
  10. Pan paniscus ppa-miR-195
  11. Pan troglodytes (chimpanzee) ptr-miR-195
  12. Pongo pygmaeus ppy-miR-195
  13. Rattus norvegicus rno-miR-195-5p
  14. Tursiops truncatus (common bottlenose dolphin) miR-195a
Publications