Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ovis aries (sheep) miscellaneous RNA URS00005B3525_9940

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGCAGCACAGAAAUAUUGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Capra hircus (goat) miR-195
  2. Equus caballus (horse) eca-miR-195
  3. Gorilla gorilla gorilla ggo-miR-195 (MIR195)
  4. Gorilla gorilla (western gorilla) ggo-miR-195
  5. Homo sapiens (human) hsa-miR-195-5p
  6. Ictidomys tridecemlineatus (thirteen-lined ground squirrel) miR-195
  7. Macaca mulatta (Rhesus monkey) mml-miR-195-5p
  8. Mus musculus (house mouse) mmu-miR-195a-5p
  9. Pan paniscus ppa-miR-195
  10. Pan troglodytes (chimpanzee) ptr-miR-195
  11. Pongo pygmaeus ppy-miR-195
  12. Rattus norvegicus rno-miR-195-5p
  13. Sus scrofa (pig) ssc-miR-195
  14. Tursiops truncatus (common bottlenose dolphin) miR-195a