v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila melanogaster (fruit fly) dme-miR-1-3p URS00005942EF_7227

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

dme-mir-1: dme-mir-1 is a member of the miR-1 family, which includes homologous miRNAs from nematodes, insects, and vertebrates. The otu-miR-1 variant of dme-mir-1 has a transformation in the 9th position and a transversion in the 10th position [PMC3468544]. The hairpin structures of dme-mir-1 precursors have been compared to other miR-1 precursors [PMC2435238]. Phylogenetic analysis supports the classification of dme-mir-1 as part of the miR-1/206 family, which includes hsa-miR-206 and Drosophila dme-mir-1 [PMC3197157]. The presence of non-template nucleotides in dme-mir-1 is not due to sequencing mistakes, as there are significantly more reads with an additional U or A compared to those with an additional G or a longer variant with 3' C [PMC3268580]. Dme-mir-1 is categorized as an intergenic miRNA [PMC4010735]. The accession number for mature dme-mir-1 was introduced in release 6.0 (2005) [PMC4142392].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGGAAUGUAAAGAAGUAUGGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 42 other species

  1. Acyrthosiphon pisum api-miR-1
  2. Aedes aegypti (yellow fever mosquito) aae-miR-1
  3. Anopheles gambiae aga-miR-1
  4. Apis mellifera ame-miR-1-3p
  5. Bactrocera dorsalis (oriental fruit fly) bdo-miR-1
  6. Blattella germanica (German cockroach) Bge-Mir-1_3p (mature (guide))
  7. Bombyx mori (domestic silkworm) bmo-miR-1a-3p
  8. Centruroides sculpturatus (bark scorpion) Csc-Mir-1-P18b_3p (mature (guide))
  9. Cochliomyia hominivorax mature cho-miR-1-3p
  10. Cochliomyia macellaria mature cma-miR-1-3p
  11. Culex quinquefasciatus cqu-miR-1
  12. Daphnia magna Dma-Mir-1_3p (mature (guide))
  13. Daphnia pulex (common water flea) dpu-miR-1
  14. Dinoponera quadriceps dqu-miR-1a-3p
  15. Drosophila ananassae dan-miR-1
  16. Drosophila erecta der-miR-1
  17. Drosophila grimshawi dgr-miR-1
  18. Drosophila mojavensis dmo-miR-1
  19. Drosophila persimilis dpe-miR-1
  20. Drosophila pseudoobscura dps-miR-1
  21. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294467_df_nrg
  22. Drosophila sechellia dse-miR-1
  23. Drosophila simulans dsi-miR-1
  24. Drosophila virilis dvi-miR-1-3p
  25. Drosophila willistoni dwi-miR-1
  26. Drosophila yakuba dya-miR-1
  27. Heliconius melpomene hme-miR-1a
  28. Hyalella azteca miR-1
  29. Ixodes ricinus (castor bean tick) iri-miR-1-3p
  30. Ixodes scapularis (black-legged tick) isc-miR-1
  31. Limulus polyphemus (Atlantic horseshoe crab) Lpo-Mir-1-P16_3p (mature (guide))
  32. Manduca sexta (tobacco hornworm) mse-miR-1a
  33. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-50153474
  34. Nasonia giraulti ngi-miR-1
  35. Nasonia vitripennis (jewel wasp) nvi-miR-1
  36. Parasteatoda tepidariorum pte-miR-1-3p
  37. Penaeus japonicus miR-1
  38. Penaeus vannamei partial Lva-miR-1
  39. Polistes canadensis pca-miR-1-3p
  40. Tetranychus urticae (two-spotted spider mite) tur-miR-1-3p
  41. Tribolium castaneum (red flour beetle) tca-miR-1-3p
  42. Triops cancriformis tcf-miR-1
 Publications