Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Apis mellifera (honey bee) ame-miR-1-3p URS00005942EF_7460

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ame-mir-1: Ame-mir-1 is a microRNA that has been shown to affect host and fungal pathogen interactions by regulating host proliferation, apoptosis, and immune response [PMC7785045]. It is speculated that the miR-1 family, which includes ame-mir-1, plays a role in the honeybee response to N. ceranae invasion [PMC6780218]. A study found a significant down-regulation of ame-mir-1 in Apis mellifera workers at 6 dpi with N. ceranae [PMC6780218]. Tests on candidate miRNAs showed similar transcription levels for both RNA strands of ame-mir-1 [PMC2394756]. Ame-mir-1 is located near ame-mir-133 and both may have similar functions in honey bees [PMC2394756]. In the larval gut of honey bees, 35 differentially expressed long non-coding RNAs (DElncRNAs) were found to target miR-1-z (highly homologous to ame-mir-1), which in turn targeted 32 differentially expressed mRNAs (DEmRNAs) [PMC9800914]. A comparison of hairpin structures showed similarities between bmo-miR-1, aga-miR-1, ame-mir-1, dme-miR-1, and dps-miR precursors [PMC2435238]. These findings highlight the importance of ame-mir-1 in regulating various biological processes in honey bees and its potential role in host-pathogen interactions.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAAUGUAAAGAAGUAUGGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 42 other species

  1. Acyrthosiphon pisum api-miR-1
  2. Aedes aegypti (yellow fever mosquito) aae-miR-1
  3. Anopheles gambiae aga-miR-1
  4. Bactrocera dorsalis (oriental fruit fly) bdo-miR-1
  5. Blattella germanica (German cockroach) Bge-Mir-1_3p (mature (guide))
  6. Bombyx mori (domestic silkworm) bmo-miR-1a-3p
  7. Centruroides sculpturatus (bark scorpion) Csc-Mir-1-P18b_3p (mature (guide))
  8. Cochliomyia hominivorax mature cho-miR-1-3p
  9. Cochliomyia macellaria mature cma-miR-1-3p
  10. Culex quinquefasciatus cqu-miR-1
  11. Daphnia magna Dma-Mir-1_3p (mature (guide))
  12. Daphnia pulex (common water flea) dpu-miR-1
  13. Dinoponera quadriceps dqu-miR-1a-3p
  14. Drosophila ananassae dan-miR-1
  15. Drosophila erecta der-miR-1
  16. Drosophila grimshawi dgr-miR-1
  17. Drosophila melanogaster (fruit fly) dme-miR-1-3p
  18. Drosophila mojavensis dmo-miR-1
  19. Drosophila persimilis dpe-miR-1
  20. Drosophila pseudoobscura dps-miR-1
  21. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294467_df_nrg
  22. Drosophila sechellia dse-miR-1
  23. Drosophila simulans dsi-miR-1
  24. Drosophila virilis dvi-miR-1-3p
  25. Drosophila willistoni dwi-miR-1
  26. Drosophila yakuba dya-miR-1
  27. Heliconius melpomene hme-miR-1a
  28. Hyalella azteca miR-1
  29. Ixodes ricinus (castor bean tick) iri-miR-1-3p
  30. Ixodes scapularis (black-legged tick) isc-miR-1
  31. Limulus polyphemus (Atlantic horseshoe crab) Lpo-Mir-1-P16_3p (mature (guide))
  32. Manduca sexta (tobacco hornworm) mse-miR-1a
  33. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-50153474
  34. Nasonia giraulti ngi-miR-1
  35. Nasonia vitripennis (jewel wasp) nvi-miR-1
  36. Parasteatoda tepidariorum pte-miR-1-3p
  37. Penaeus japonicus miR-1
  38. Penaeus vannamei partial Lva-miR-1
  39. Polistes canadensis pca-miR-1-3p
  40. Tetranychus urticae (two-spotted spider mite) tur-miR-1-3p
  41. Tribolium castaneum (red flour beetle) tca-miR-1-3p
  42. Triops cancriformis tcf-miR-1
Publications