v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ixodes scapularis (black-legged tick) isc-miR-1 URS00005942EF_6945

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

isc-mir-1: Isc-mir-1 is a known I. scapularis miRNA that is significantly up- or down-regulated in response to POWV-infected tick feeding [PMC6739385]. Aae-miR-1-5p, a miRNA in A. aegypti, showed a similar up-regulation pattern to isc-mir-1 in response to Zika virus infection [PMC6739385]. In an in vitro miRNA inhibition assay, isc-mir-1 was selected for inclusion and its inhibition resulted in significantly higher POWV titers at 72 and 96 hours post-infection [PMC6739385]. In response to 3 hours of POWV-infected tick feeding, isc-mir-1 was significantly up-regulated along with isc-miR-315 and isc-miR-79 [PMC6739385]. Among the 24 salivary gland miRNAs that were significantly up-regulated in response to infected tick feeding, four of them matched known I. scapularis mature miRNAs, including isc-mir-1 [PMC6739385]. Additionally, isc-mir-1 was among the 50 most abundant miRNAs from the POWV-infected salivary gland libraries at the 3-hour time point [PMC6739385]. In B. burgdorferi-infected salivary glands, isc-mir-153, isc-mir-1 and isc-miR79 were downregulated while several other miRNAs including iscmiR317 and iscmiR5310 were upregulated [PMC9141961].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGGAAUGUAAAGAAGUAUGGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 42 other species

  1. Acyrthosiphon pisum api-miR-1
  2. Aedes aegypti (yellow fever mosquito) aae-miR-1
  3. Anopheles gambiae aga-miR-1
  4. Apis mellifera ame-miR-1-3p
  5. Bactrocera dorsalis (oriental fruit fly) bdo-miR-1
  6. Blattella germanica (German cockroach) Bge-Mir-1_3p (mature (guide))
  7. Bombyx mori (domestic silkworm) bmo-miR-1a-3p
  8. Centruroides sculpturatus (bark scorpion) Csc-Mir-1-P18b_3p (mature (guide))
  9. Cochliomyia hominivorax mature cho-miR-1-3p
  10. Cochliomyia macellaria mature cma-miR-1-3p
  11. Culex quinquefasciatus cqu-miR-1
  12. Daphnia magna Dma-Mir-1_3p (mature (guide))
  13. Daphnia pulex (common water flea) dpu-miR-1
  14. Dinoponera quadriceps dqu-miR-1a-3p
  15. Drosophila ananassae dan-miR-1
  16. Drosophila erecta der-miR-1
  17. Drosophila grimshawi dgr-miR-1
  18. Drosophila melanogaster (fruit fly) dme-miR-1-3p
  19. Drosophila mojavensis dmo-miR-1
  20. Drosophila persimilis dpe-miR-1
  21. Drosophila pseudoobscura dps-miR-1
  22. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294467_df_nrg
  23. Drosophila sechellia dse-miR-1
  24. Drosophila simulans dsi-miR-1
  25. Drosophila virilis dvi-miR-1-3p
  26. Drosophila willistoni dwi-miR-1
  27. Drosophila yakuba dya-miR-1
  28. Heliconius melpomene hme-miR-1a
  29. Hyalella azteca miR-1
  30. Ixodes ricinus (castor bean tick) iri-miR-1-3p
  31. Limulus polyphemus (Atlantic horseshoe crab) Lpo-Mir-1-P16_3p (mature (guide))
  32. Manduca sexta (tobacco hornworm) mse-miR-1a
  33. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-50153474
  34. Nasonia giraulti ngi-miR-1
  35. Nasonia vitripennis (jewel wasp) nvi-miR-1
  36. Parasteatoda tepidariorum pte-miR-1-3p
  37. Penaeus japonicus miR-1
  38. Penaeus vannamei partial Lva-miR-1
  39. Polistes canadensis pca-miR-1-3p
  40. Tetranychus urticae (two-spotted spider mite) tur-miR-1-3p
  41. Tribolium castaneum (red flour beetle) tca-miR-1-3p
  42. Triops cancriformis tcf-miR-1
 Publications