v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bombyx mori (domestic silkworm) bmo-miR-1a-3p URS00005942EF_7091

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bmo-mir-1a: According to Zhang et al. (2013) [PMC3827265], the five most abundant miRNAs were bmo-mir-1a, bmo-miR-8, bmo-miR-308, bmo-miR-100, and PN-bmo-miR-276*. Wang et al. (2014) [PMC4222307] successfully transfected miRNA vectors into BmN cells and used quantitative RT-PCR (qRT-PCR) analysis to measure the relative abundances of bmo-mir-1a, bmo-mir-8, and bmo-mir-133 in BmN cells. Huangfu et al. (2013) [PMC3699532] validated the sequence data and found that bmo-mir-1a, along with other miRNAs such as bmo-miR-14, bmo-miR-9a, and bmo-miR-274, was down-regulated. They also suggested that bmo-mir-1a may be related to viral infection. Furthermore, the analysis of putative target genes revealed that bmo-mir-1a is involved in response to stimulus and immune system processes. The down-regulation of bmo-mir-1a was also observed in BmCPV-infected midgut samples (Huangfu et al., 2013) [PMC3699532].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGGAAUGUAAAGAAGUAUGGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 42 other species

  1. Acyrthosiphon pisum api-miR-1
  2. Aedes aegypti (yellow fever mosquito) aae-miR-1
  3. Anopheles gambiae aga-miR-1
  4. Apis mellifera ame-miR-1-3p
  5. Bactrocera dorsalis (oriental fruit fly) bdo-miR-1
  6. Blattella germanica (German cockroach) Bge-Mir-1_3p (mature (guide))
  7. Centruroides sculpturatus (bark scorpion) Csc-Mir-1-P18b_3p (mature (guide))
  8. Cochliomyia hominivorax mature cho-miR-1-3p
  9. Cochliomyia macellaria mature cma-miR-1-3p
  10. Culex quinquefasciatus cqu-miR-1
  11. Daphnia magna Dma-Mir-1_3p (mature (guide))
  12. Daphnia pulex (common water flea) dpu-miR-1
  13. Dinoponera quadriceps dqu-miR-1a-3p
  14. Drosophila ananassae dan-miR-1
  15. Drosophila erecta der-miR-1
  16. Drosophila grimshawi dgr-miR-1
  17. Drosophila melanogaster (fruit fly) dme-miR-1-3p
  18. Drosophila mojavensis dmo-miR-1
  19. Drosophila persimilis dpe-miR-1
  20. Drosophila pseudoobscura dps-miR-1
  21. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294467_df_nrg
  22. Drosophila sechellia dse-miR-1
  23. Drosophila simulans dsi-miR-1
  24. Drosophila virilis dvi-miR-1-3p
  25. Drosophila willistoni dwi-miR-1
  26. Drosophila yakuba dya-miR-1
  27. Heliconius melpomene hme-miR-1a
  28. Hyalella azteca miR-1
  29. Ixodes ricinus (castor bean tick) iri-miR-1-3p
  30. Ixodes scapularis (black-legged tick) isc-miR-1
  31. Limulus polyphemus (Atlantic horseshoe crab) Lpo-Mir-1-P16_3p (mature (guide))
  32. Manduca sexta (tobacco hornworm) mse-miR-1a
  33. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-50153474
  34. Nasonia giraulti ngi-miR-1
  35. Nasonia vitripennis (jewel wasp) nvi-miR-1
  36. Parasteatoda tepidariorum pte-miR-1-3p
  37. Penaeus japonicus miR-1
  38. Penaeus vannamei partial Lva-miR-1
  39. Polistes canadensis pca-miR-1-3p
  40. Tetranychus urticae (two-spotted spider mite) tur-miR-1-3p
  41. Tribolium castaneum (red flour beetle) tca-miR-1-3p
  42. Triops cancriformis tcf-miR-1
 Publications