Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-27b URS000059311D_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-27b: Bta-mir-27b is a microRNA that was included in the reverse transcription process using the ID3EAL cDNA Synthesis System [PMC9737596]. It is part of the miR-27 family, which also includes bta-miR-27a [PMC3589390]. The miR-27 family is one of seven different miRNA families that were studied [PMC3589390]. The expression levels of bta-mir-27b were found to be high in multiple tissues from both beef and dairy animals [PMC7653039]. Additionally, high expression levels were also observed for bta-miR-143 in these tissues [PMC7653039]. References: [PMC9737596] - This reference provides information about the ID3EAL cDNA Synthesis System and its use in reverse transcription. [PMC3589390] - This reference provides information about the different miRNA families studied, including the miR-27 family. [PMC7653039] - This reference reports on the high expression levels of bta-mir-27b and bta-miR-143 in multiple tissues from beef and dairy animals.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCACAGUGGCUAAGUUCUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 57 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-27-P2_3p (mature (guide))
  2. Anolis carolinensis (green anole) Aca-Mir-27-P2_3p (mature (guide))
  3. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-27b
  4. Canis lupus familiaris (dog) cfa-miR-27b
  5. Capra hircus (goat) chi-miR-27b-3p
  6. Cavia porcellus cpo-miR-27b-3p
  7. Cervus elaphus (red deer) cel-miR-27b
  8. Chiloscyllium plagiosum microRNA cpl-miR-27b
  9. Chrysemys picta bellii Cpi-Mir-27-P2_3p (mature (guide))
  10. Chrysemys picta (Painted turtle) cpi-miR-27b-3p
  11. Columba livia cli-miR-27b-3p
  12. Cricetulus griseus cgr-miR-27b-3p
  13. Danio rerio (zebrafish) Dre-Mir-27-P2b_3p (mature (guide))
  14. Dasypus novemcinctus (nine-banded armadillo) dno-miR-27b-3p
  15. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-27-P2_3p (mature (guide))
  16. Equus caballus (horse) eca-miR-27b
  17. Gadus morhua Gmo-Mir-27-P2b_3p (mature (guide))
  18. Gallus gallus gga-miR-27b-3p
  19. Gekko japonicus Gja-Mir-27-P2_3p (mature (guide))
  20. Gorilla gorilla gorilla ggo-miR-27b (MIR27B)
  21. Gorilla gorilla ggo-miR-27b
  22. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-27b
  23. Homo sapiens (human) hsa-miR-27b-3p
  24. Ictalurus punctatus (channel catfish) ipu-miR-27b
  25. Latimeria chalumnae Lch-Mir-27-P1_3p (mature (guide))
  26. Lepisosteus oculatus (spotted gar) Loc-Mir-27-P2_3p (mature (guide))
  27. Macaca mulatta (Rhesus monkey) mml-miR-27b-3p
  28. Maylandia zebra (zebra mbuna) mze-miR-27b
  29. Microcaecilia unicolor Mun-Mir-27-P2_3p (mature (guide))
  30. Microcebus murinus mmr-miR-27b
  31. Monodelphis domestica mdo-miR-27b-3p
  32. Monopterus albus Mal-Mir-27-P2b_3p (mature (guide))
  33. Mus musculus (house mouse) mmu-miR-27b-3p
  34. Neolamprologus brichardi (lyretail cichlid) nbr-miR-27b
  35. Oreochromis niloticus oni-miR-27b
  36. Ornithorhynchus anatinus (platypus) oan-miR-27b-3p
  37. Oryctolagus cuniculus (rabbit) ocu-miR-27b-3p
  38. Ovis aries (sheep) miscellaneous RNA
  39. Pan paniscus (pygmy chimpanzee) ppa-miR-27b
  40. Pan troglodytes ptr-miR-27b
  41. Petromyzon marinus pma-miR-27b-3p
  42. Pongo pygmaeus ppy-miR-27b
  43. Pteropus alecto pal-miR-27b-3p
  44. Pundamilia nyererei pny-miR-27b
  45. Python bivittatus (Burmese python) pbv-miR-27b-3p
  46. Rattus norvegicus rno-miR-27b-3p
  47. Saimiri boliviensis boliviensis sbo-miR-27b
  48. Salmo salar ssa-miR-27b-3p
  49. Sarcophilus harrisii (Tasmanian devil) sha-miR-27b
  50. Sphenodon punctatus (tuatara) Spt-Mir-27-P2_3p (mature (guide))
  51. Sus scrofa (pig) ssc-miR-27b-3p
  52. Taeniopygia guttata tgu-miR-27-3p
  53. Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-27-P2b_3p (mature (guide))
  54. Tupaia chinensis tch-miR-27b-3p
  55. Tursiops truncatus (common bottlenose dolphin) miR-27b
  56. Xenopus laevis (African clawed frog) Xla-Mir-27-P2c_3p (mature (guide))
  57. Xenopus tropicalis (tropical clawed frog) xtr-miR-27b
Publications