Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-27b-3p URS000059311D_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-mir-27b: Gga-mir-27b is a microRNA that has been found to be involved in various biological processes, including antiviral responses and fat deposition in chickens. In the context of IBDV infection, gga-mir-27b expression is increased in DF-1 cells, and it can suppress IBDV replication by upregulating the expression of IFN-β, IRF3, and NF-κB through the targeting of SOCS3 and 6 [PMC9607458]. It has been shown that gga-mir-27b is demethylated after IBDV infection, leading to increased expression of gga-miR-27b-3p [PMC7291112]. Additionally, gga-miR-27b has been found to be differentially expressed in various viral infections, including avian influenza virus infection in chicken lungs [PMC5389138]. In terms of fat deposition in chickens, gga-miR-27b is one of the miRNAs that increase significantly after sexual maturity [PMC8002044]. Furthermore, gga-mir-27b has been identified as one of the least abundant miRNAs in 8% PEG precipitated TEX [PMC7734234]. TargetScan analysis has predicted putative targets for gga-mir-27b among muscle-related miRNAs [PMC3107184]. Lastly, gga-miR-221 and gga-miR222 are among the miRNAs that are co-expressed with gga-mir-27b and can influence the function of mature DCs [PMC4735322].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCACAGUGGCUAAGUUCUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 57 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-27-P2_3p (mature (guide))
  2. Anolis carolinensis Aca-Mir-27-P2_3p (mature (guide))
  3. Bos taurus bta-miR-27b
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-27b
  5. Canis lupus familiaris cfa-miR-27b
  6. Capra hircus chi-miR-27b-3p
  7. Cavia porcellus cpo-miR-27b-3p
  8. Cervus elaphus (red deer) cel-miR-27b
  9. Chiloscyllium plagiosum microRNA cpl-miR-27b
  10. Chrysemys picta bellii (western painted turtle) Cpi-Mir-27-P2_3p (mature (guide))
  11. Chrysemys picta (Painted turtle) cpi-miR-27b-3p
  12. Columba livia cli-miR-27b-3p
  13. Cricetulus griseus (Chinese hamster) cgr-miR-27b-3p
  14. Danio rerio Dre-Mir-27-P2b_3p (mature (guide))
  15. Dasypus novemcinctus dno-miR-27b-3p
  16. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-27-P2_3p (mature (guide))
  17. Equus caballus (horse) eca-miR-27b
  18. Gadus morhua Gmo-Mir-27-P2b_3p (mature (guide))
  19. Gekko japonicus Gja-Mir-27-P2_3p (mature (guide))
  20. Gorilla gorilla gorilla ggo-miR-27b (MIR27B)
  21. Gorilla gorilla ggo-miR-27b
  22. Haplochromis burtoni abu-miR-27b
  23. Homo sapiens hsa-miR-27b-3p
  24. Ictalurus punctatus (channel catfish) ipu-miR-27b
  25. Latimeria chalumnae Lch-Mir-27-P1_3p (mature (guide))
  26. Lepisosteus oculatus Loc-Mir-27-P2_3p (mature (guide))
  27. Macaca mulatta (Rhesus monkey) mml-miR-27b-3p
  28. Maylandia zebra mze-miR-27b
  29. Microcaecilia unicolor Mun-Mir-27-P2_3p (mature (guide))
  30. Microcebus murinus (gray mouse lemur) mmr-miR-27b
  31. Monodelphis domestica (gray short-tailed opossum) mdo-miR-27b-3p
  32. Monopterus albus Mal-Mir-27-P2b_3p (mature (guide))
  33. Mus musculus (house mouse) mmu-miR-27b-3p
  34. Neolamprologus brichardi nbr-miR-27b
  35. Oreochromis niloticus (Nile tilapia) oni-miR-27b
  36. Ornithorhynchus anatinus (platypus) oan-miR-27b-3p
  37. Oryctolagus cuniculus (rabbit) ocu-miR-27b-3p
  38. Ovis aries miscellaneous RNA
  39. Pan paniscus (pygmy chimpanzee) ppa-miR-27b
  40. Pan troglodytes (chimpanzee) ptr-miR-27b
  41. Petromyzon marinus (sea lamprey) pma-miR-27b-3p
  42. Pongo pygmaeus ppy-miR-27b
  43. Pteropus alecto (black flying fox) pal-miR-27b-3p
  44. Pundamilia nyererei pny-miR-27b
  45. Python bivittatus pbv-miR-27b-3p
  46. Rattus norvegicus rno-miR-27b-3p
  47. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-27b
  48. Salmo salar ssa-miR-27b-3p
  49. Sarcophilus harrisii (Tasmanian devil) sha-miR-27b
  50. Sphenodon punctatus Spt-Mir-27-P2_3p (mature (guide))
  51. Sus scrofa ssc-miR-27b-3p
  52. Taeniopygia guttata tgu-miR-27-3p
  53. Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-27-P2b_3p (mature (guide))
  54. Tupaia chinensis tch-miR-27b-3p
  55. Tursiops truncatus (common bottlenose dolphin) miR-27b
  56. Xenopus laevis (African clawed frog) Xla-Mir-27-P2c_3p (mature (guide))
  57. Xenopus tropicalis (tropical clawed frog) xtr-miR-27b
Publications