Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sorghum bicolor (sorghum) sbi-miR169a URS000052B358_4558

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGCCAAGGAUGACUUGCCGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

  1. Aegilops tauschii ata-miR169e-5p
  2. Ananas comosus (pineapple) microRNA 169a
  3. Arabidopsis lyrata (lyrate rockcress) aly-miR169a-5p
  4. Arabidopsis thaliana (thale cress) ath-miR169a-5p
  5. Brachypodium distachyon (stiff brome) bdi-miR169a-5p
  6. Brassica napus (rape) bna-miR169b
  7. Camelina sativa cas-miR169a
  8. Glycine max gma-miR169b
  9. Linum usitatissimum lus-miR169l
  10. Manihot esculenta mes-miR169g
  11. Medicago truncatula (barrel medic) mtr-miR169a
  12. Nicotiana tabacum (common tobacco) nta-miR169i
  13. Oryza sativa (Asian cultivated rice) osa-miR169a
  14. Oryza sativa Japonica Group microRNA osa-miR169a
  15. Populus trichocarpa (black cottonwood) ptc-miR169b-5p
  16. Solanum lycopersicum sly-miR169c
  17. Theobroma cacao (cacao) tcc-miR169e
  18. Vitis vinifera vvi-miR169f
  19. Zea mays (maize) zma-miR169b-5p
Publications