v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Zea mays (maize) zma-miR169b-5p URS000052B358_4577

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

zma-miR169a-5p: Four miRNAs (zma-mir169a-5p, zma-miR169c-5p, zma-miR169i-5p, and zma-miR395b-5p) that were specifically repressed in FZB42 treatment were selected as candidate ISR-associated miRNAs [PMC6829523]. These miRNAs belong to the miR169 family and form a network with their target mRNAs [PMC6829523]. The miR825/miR825 * pair, miR472, miR846, and the four candidate miRNAs (including zma-mir169a-5p) have been reported to regulate ISR activated by different Bacillus spp., which are beneficial plant-associated bacteria [PMC9964586]. Additionally, these four specific miRNAs (zma-mir169a-5p, zma-miR169c-5p, zma-miR169i-5p, and zma-miR395b-5p) were found to be specifically repressed in FZB42 treatment and were selected as candidates for ISR-associated miRNAs [PMC8839143].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CAGCCAAGGAUGACUUGCCGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

  1. Aegilops tauschii ata-miR169e-5p
  2. Ananas comosus (pineapple) microRNA 169a
  3. Arabidopsis lyrata (lyrate rockcress) aly-miR169a-5p
  4. Arabidopsis thaliana (thale cress) ath-miR169a-5p
  5. Brachypodium distachyon (stiff brome) bdi-miR169a-5p
  6. Brassica napus (rape) bna-miR169b
  7. Camelina sativa cas-miR169a
  8. Glycine max gma-miR169b
  9. Linum usitatissimum lus-miR169l
  10. Manihot esculenta mes-miR169g
  11. Medicago truncatula (barrel medic) mtr-miR169a
  12. Nicotiana tabacum (common tobacco) nta-miR169i
  13. Oryza sativa (Asian cultivated rice) osa-miR169a
  14. Oryza sativa Japonica Group microRNA osa-miR169a
  15. Populus trichocarpa (black cottonwood) ptc-miR169b-5p
  16. Solanum lycopersicum sly-miR169c
  17. Sorghum bicolor (sorghum) sbi-miR169a
  18. Theobroma cacao (cacao) tcc-miR169e
  19. Vitis vinifera vvi-miR169f
 Publications