Arabidopsis lyrata (lyrate rockcress) aly-miR169a-5p URS000052B358_59689

• 21 nucleotides
• 2 databases (ENA, miRBase)
• Found in 19 other species
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

CAGCCAAGGAUGACUUGCCGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

1. Aegilops tauschii ata-miR169e-5p
2. Ananas comosus (pineapple) microRNA 169a
3. Arabidopsis thaliana (thale cress) ath-miR169a-5p
4. Brachypodium distachyon (stiff brome) bdi-miR169a-5p
5. Brassica napus (rape) bna-miR169b
6. Camelina sativa cas-miR169a
7. Glycine max gma-miR169b
8. Linum usitatissimum lus-miR169l
9. Manihot esculenta mes-miR169g
10. Medicago truncatula (barrel medic) mtr-miR169a
11. Nicotiana tabacum (common tobacco) nta-miR169i
12. Oryza sativa (Asian cultivated rice) osa-miR169a
13. Oryza sativa Japonica Group microRNA osa-miR169a
14. Populus trichocarpa (black cottonwood) ptc-miR169b-5p
15. Solanum lycopersicum sly-miR169c
16. Sorghum bicolor (sorghum) sbi-miR169a
17. Theobroma cacao (cacao) tcc-miR169e
18. Vitis vinifera vvi-miR169f
19. Zea mays (maize) zma-miR169b-5p

Download

• FASTA
• JSON