v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-30b-5p URS00005165DA_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (MalaCards, miRBase, GeneCards, MirGeneDB, TarBase, ENA, RefSeq, LncBase). Homo sapiens (human) hsa-miR-30b-5p sequence is a product of MIR30B, hsa-miR-30b-5p, miR-30, miR-30b, hsa-miR-30b, miR-30b-5p genes. Found in the Homo sapiens reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 14-3-3, 14-3-3-zeta, 14-3-3GAMMA, 14-3-3γ, 182-FIP, 1A1-3B, 1R20, 2C4D, 2HOR0202, 3'HEXO.

mRNA interactions 5 total

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Localisation

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    UGUAAACAUCCUACACUCAGCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 56 other species

    1. Alligator mississippiensis ami-miR-30b-5p
    2. Anolis carolinensis (green anole) aca-miR-30b-5p
    3. Bos taurus bta-miR-30b-5p
    4. Callithrix jacchus cja-miR-30b
    5. Callorhinchus milii Cmi-Mir-30-P2a_5p (mature (guide))
    6. Canis lupus familiaris (dog) cfa-miR-30b
    7. Capra hircus (goat) chi-miR-30b-5p
    8. Cavia porcellus cpo-miR-30b-5p
    9. Cervus elaphus cel-miR-30b-5p
    10. Chiloscyllium plagiosum microRNA cpl-miR-30b
    11. Chrysemys picta bellii Cpi-Mir-30-P2a_5p (mature (guide))
    12. Chrysemys picta cpi-miR-30b-5p
    13. Cricetulus griseus (Chinese hamster) cgr-miR-30b-5p
    14. Cyprinus carpio ccr-miR-30b
    15. Danio rerio (zebrafish) dre-miR-30b
    16. Dasypus novemcinctus dno-miR-30b-5p
    17. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-30-P2a_5p (mature (guide))
    18. Equus caballus (horse) eca-miR-30b
    19. Gadus morhua gmo-miR-30c-5p
    20. Gallus gallus (chicken) gga-miR-30b-5p
    21. Gekko japonicus Gja-Mir-30-P2a_5p (mature (guide))
    22. Haplochromis burtoni abu-miR-30d
    23. Ictalurus punctatus ipu-miR-30b
    24. Latimeria chalumnae Lch-Mir-30-P2a_5p (mature (guide))
    25. Lepisosteus oculatus Loc-Mir-30-P2a_5p (mature (guide))
    26. Macaca mulatta Mml-Mir-30-P2a_5p (mature (guide))
    27. Maylandia zebra (zebra mbuna) mze-miR-30d
    28. Microcaecilia unicolor Mun-Mir-30-P2a_5p (mature (guide))
    29. Monodelphis domestica (gray short-tailed opossum) mdo-miR-30b-5p
    30. Monopterus albus Mal-Mir-30-P2a_5p (mature (guide))
    31. Mus musculus (house mouse) mmu-miR-30b-5p
    32. Neolamprologus brichardi nbr-miR-30d
    33. Nomascus leucogenys nle-miR-30b
    34. Ophiophagus hannah oha-miR-30b-5p
    35. Oreochromis niloticus (Nile tilapia) oni-miR-30d
    36. Ornithorhynchus anatinus (platypus) oan-miR-30b-5p
    37. Oryctolagus cuniculus ocu-miR-30b-5p
    38. Otolemur garnettii oga-miR-30b
    39. Ovis aries miscellaneous RNA
    40. Pongo pygmaeus (Bornean orangutan) ppy-miR-30b
    41. Pteropus alecto pal-miR-30b-5p
    42. Pundamilia nyererei pny-miR-30d
    43. Python bivittatus pbv-miR-30b-5p
    44. Rattus norvegicus rno-miR-30b-5p
    45. Salmo salar (Atlantic salmon) ssa-miR-30e-5p
    46. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-30-P2a_5p (mature (guide))
    47. Scyliorhinus torazame Sto-Mir-30-P2a_5p (mature (guide))
    48. Sphenodon punctatus Spt-Mir-30-P2a_5p (mature (guide))
    49. Sus scrofa (pig) ssc-miR-30b-5p
    50. Taeniopygia guttata tgu-miR-30e
    51. Takifugu rubripes (torafugu) fru-miR-30b
    52. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-30b
    53. Tupaia chinensis (Chinese tree shrew) tch-miR-30b-5p
    54. Tursiops truncatus miR-30b-5p
    55. Xenopus laevis (African clawed frog) xla-miR-30b-5p
    56. Xenopus tropicalis (tropical clawed frog) xtr-miR-30b
     Publications