Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-30b URS00005165DA_9615

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cfa-mir-30b: Cfa-mir-30b is a microRNA that has been analyzed in the plasma of Dachshunds with mitral valve disease (MMVD). Two studies have identified cfa-mir-30b as a significantly downregulated miRNA in dogs with MMVD, specifically in Stage B and dogs with moderate cardiac enlargement [PMC4490541] [PMC4964495]. Another study found that cfa-mir-30b, along with cfa-miR-133b, regulates connective tissue growth factor, which is important in the development and progression of canine mitral valve diseases [PMC7924183]. Cfa-mir-30b was also selected for validation in a microarray study along with other miRNAs [PMC5678797]. Furthermore, the downregulation of cfa-mir-30b and cfa-miR-133b has been observed in plasma miRNA analysis of Dachshunds with MMVD [PMC5533140]. In a previous study, dysregulation of cfa-mir-30b was found only in MMVD Stage B dogs compared to healthy dogs [PMC8542680]. Additionally, adrenal cortex samples have shown that cfa-miR-30 family (including cfa-miR-30a, cfa-mir-30b, cfa-miR-30c, and cfa-miR-30d) is among the most abundant known miRNAs [PMC4768678]. Overall, these studies highlight the significance of downregulated expression of cfa-mir-30b in MMVD and its potential role as a biomarker for disease progression.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUAAACAUCCUACACUCAGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 56 other species

  1. Alligator mississippiensis ami-miR-30b-5p
  2. Anolis carolinensis (green anole) aca-miR-30b-5p
  3. Bos taurus (cattle) bta-miR-30b-5p
  4. Callithrix jacchus cja-miR-30b
  5. Callorhinchus milii Cmi-Mir-30-P2a_5p (mature (guide))
  6. Capra hircus (goat) chi-miR-30b-5p
  7. Cavia porcellus (domestic guinea pig) cpo-miR-30b-5p
  8. Cervus elaphus (red deer) cel-miR-30b-5p
  9. Chiloscyllium plagiosum microRNA cpl-miR-30b
  10. Chrysemys picta bellii (western painted turtle) Cpi-Mir-30-P2a_5p (mature (guide))
  11. Chrysemys picta (Painted turtle) cpi-miR-30b-5p
  12. Cricetulus griseus (Chinese hamster) cgr-miR-30b-5p
  13. Cyprinus carpio ccr-miR-30b
  14. Danio rerio dre-miR-30b
  15. Dasypus novemcinctus (nine-banded armadillo) dno-miR-30b-5p
  16. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-30-P2a_5p (mature (guide))
  17. Equus caballus eca-miR-30b
  18. Gadus morhua gmo-miR-30c-5p
  19. Gallus gallus (chicken) gga-miR-30b-5p
  20. Gekko japonicus Gja-Mir-30-P2a_5p (mature (guide))
  21. Haplochromis burtoni abu-miR-30d
  22. Homo sapiens hsa-miR-30b-5p
  23. Ictalurus punctatus ipu-miR-30b
  24. Latimeria chalumnae Lch-Mir-30-P2a_5p (mature (guide))
  25. Lepisosteus oculatus Loc-Mir-30-P2a_5p (mature (guide))
  26. Macaca mulatta (Rhesus monkey) Mml-Mir-30-P2a_5p (mature (guide))
  27. Maylandia zebra mze-miR-30d
  28. Microcaecilia unicolor Mun-Mir-30-P2a_5p (mature (guide))
  29. Monodelphis domestica (gray short-tailed opossum) mdo-miR-30b-5p
  30. Monopterus albus (swamp eel) Mal-Mir-30-P2a_5p (mature (guide))
  31. Mus musculus mmu-miR-30b-5p
  32. Neolamprologus brichardi (lyretail cichlid) nbr-miR-30d
  33. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-30b
  34. Ophiophagus hannah (king cobra) oha-miR-30b-5p
  35. Oreochromis niloticus oni-miR-30d
  36. Ornithorhynchus anatinus (platypus) oan-miR-30b-5p
  37. Oryctolagus cuniculus ocu-miR-30b-5p
  38. Otolemur garnettii (small-eared galago) oga-miR-30b
  39. Ovis aries miscellaneous RNA
  40. Pongo pygmaeus (Bornean orangutan) ppy-miR-30b
  41. Pteropus alecto pal-miR-30b-5p
  42. Pundamilia nyererei pny-miR-30d
  43. Python bivittatus (Burmese python) pbv-miR-30b-5p
  44. Rattus norvegicus rno-miR-30b-5p
  45. Salmo salar (Atlantic salmon) ssa-miR-30e-5p
  46. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-30-P2a_5p (mature (guide))
  47. Scyliorhinus torazame Sto-Mir-30-P2a_5p (mature (guide))
  48. Sphenodon punctatus (tuatara) Spt-Mir-30-P2a_5p (mature (guide))
  49. Sus scrofa (pig) ssc-miR-30b-5p
  50. Taeniopygia guttata tgu-miR-30e
  51. Takifugu rubripes (torafugu) fru-miR-30b
  52. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-30b
  53. Tupaia chinensis (Chinese tree shrew) tch-miR-30b-5p
  54. Tursiops truncatus (common bottlenose dolphin) miR-30b-5p
  55. Xenopus laevis xla-miR-30b-5p
  56. Xenopus tropicalis xtr-miR-30b
Publications