Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-30b-5p URS00005165DA_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-mir-30b: The gga-mir-30b is a member of the gga-miR-30 family, which consists of five members, including gga-miR-30a, gga-mir-30b, gga-miR-30c, gga-miR-30d, and gga-miR-30e. These members share a seed sequence but differ at their 3' ends, allowing for a slightly different repertoire of targets [PMC7936154]. Previous studies have shown that gga-mir-30b is differentially expressed in various contexts. For example, it is differentially expressed in chicken lungs infected with avian influenza virus [PMC7936154]. Additionally, it is differentially expressed in A549 cells infected with swine-origin H1N1 or avian-origin H7N7 influenza A virus [PMC7936154]. In mice infected with recombinant influenza A H1N1 virus strains or highly pathogenic H5N1 avian virus in cynomolgus macaques, the expression of gga-mir-30b was also altered [PMC7936154]. Furthermore, it has been shown that gga-mir-30b targets the M and NA genes of avian influenza virus [PMC3496578]. In chicken lung and trachea infected with avian influenza virus, the expression of several miRNAs including gga-mir-30b was found to be differentially regulated [PMC5389138]. Finally, in RSS chicken samples four up-regulated miRNAs (gga-miR-221, gga-mir-30b,g ga-miR- 3c and ga -miR -215) and one down-regulated miRNA (g ga -mi R -375) were validated using RT-qPCR [PMC4444097].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUAAACAUCCUACACUCAGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 56 other species

  1. Alligator mississippiensis ami-miR-30b-5p
  2. Anolis carolinensis (green anole) aca-miR-30b-5p
  3. Bos taurus (cattle) bta-miR-30b-5p
  4. Callithrix jacchus cja-miR-30b
  5. Callorhinchus milii Cmi-Mir-30-P2a_5p (mature (guide))
  6. Canis lupus familiaris (dog) cfa-miR-30b
  7. Capra hircus (goat) chi-miR-30b-5p
  8. Cavia porcellus (domestic guinea pig) cpo-miR-30b-5p
  9. Cervus elaphus (red deer) cel-miR-30b-5p
  10. Chiloscyllium plagiosum microRNA cpl-miR-30b
  11. Chrysemys picta bellii (western painted turtle) Cpi-Mir-30-P2a_5p (mature (guide))
  12. Chrysemys picta (Painted turtle) cpi-miR-30b-5p
  13. Cricetulus griseus (Chinese hamster) cgr-miR-30b-5p
  14. Cyprinus carpio ccr-miR-30b
  15. Danio rerio dre-miR-30b
  16. Dasypus novemcinctus (nine-banded armadillo) dno-miR-30b-5p
  17. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-30-P2a_5p (mature (guide))
  18. Equus caballus eca-miR-30b
  19. Gadus morhua gmo-miR-30c-5p
  20. Gekko japonicus Gja-Mir-30-P2a_5p (mature (guide))
  21. Haplochromis burtoni abu-miR-30d
  22. Homo sapiens hsa-miR-30b-5p
  23. Ictalurus punctatus ipu-miR-30b
  24. Latimeria chalumnae Lch-Mir-30-P2a_5p (mature (guide))
  25. Lepisosteus oculatus Loc-Mir-30-P2a_5p (mature (guide))
  26. Macaca mulatta (Rhesus monkey) Mml-Mir-30-P2a_5p (mature (guide))
  27. Maylandia zebra mze-miR-30d
  28. Microcaecilia unicolor Mun-Mir-30-P2a_5p (mature (guide))
  29. Monodelphis domestica (gray short-tailed opossum) mdo-miR-30b-5p
  30. Monopterus albus (swamp eel) Mal-Mir-30-P2a_5p (mature (guide))
  31. Mus musculus mmu-miR-30b-5p
  32. Neolamprologus brichardi (lyretail cichlid) nbr-miR-30d
  33. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-30b
  34. Ophiophagus hannah (king cobra) oha-miR-30b-5p
  35. Oreochromis niloticus oni-miR-30d
  36. Ornithorhynchus anatinus (platypus) oan-miR-30b-5p
  37. Oryctolagus cuniculus ocu-miR-30b-5p
  38. Otolemur garnettii (small-eared galago) oga-miR-30b
  39. Ovis aries miscellaneous RNA
  40. Pongo pygmaeus (Bornean orangutan) ppy-miR-30b
  41. Pteropus alecto pal-miR-30b-5p
  42. Pundamilia nyererei pny-miR-30d
  43. Python bivittatus (Burmese python) pbv-miR-30b-5p
  44. Rattus norvegicus rno-miR-30b-5p
  45. Salmo salar (Atlantic salmon) ssa-miR-30e-5p
  46. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-30-P2a_5p (mature (guide))
  47. Scyliorhinus torazame Sto-Mir-30-P2a_5p (mature (guide))
  48. Sphenodon punctatus (tuatara) Spt-Mir-30-P2a_5p (mature (guide))
  49. Sus scrofa (pig) ssc-miR-30b-5p
  50. Taeniopygia guttata tgu-miR-30e
  51. Takifugu rubripes (torafugu) fru-miR-30b
  52. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-30b
  53. Tupaia chinensis (Chinese tree shrew) tch-miR-30b-5p
  54. Tursiops truncatus (common bottlenose dolphin) miR-30b-5p
  55. Xenopus laevis xla-miR-30b-5p
  56. Xenopus tropicalis xtr-miR-30b
Publications