Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-30b-5p URS00005165DA_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-30b: Rno-mir-30b is a microRNA that is processed into two mature forms, rno-mir-30b-3p and rno-mir-30b-5p, and their targets were combined for further analysis [PMC2990713]. The same was done for rno-mir-30d, where the targets of rno-miR-30d and rno-miR-30d* were merged [PMC2990713]. Rno-mir-30b has 1868 targets, while rno-mir-30d has 1776 targets [PMC2990713]. Rno-mir-30b and rno-mir-30d are both covered by a "gain" region on chromosome 7 within a region of only 3.8 Kb [PMC2990713]. These microRNA genes are part of a set of T2D-associated CNV regions that include several novel T2D susceptibility loci involving protein-coding genes and two microRNA genes [PMC2990713] [PMC4631338]. Rno-mir-30b overexpression has been shown to have an anti-apoptotic effect on cardiomyocytes during the early phase of myocardial IR injury in a rat model [PMC7238603]. Only five dysregulated miRNAs, including rno-miR183/96, rno-miR-150, and rno-miR206, were observed in two or more studies, suggesting that various factors can influence miRNA expression in different contexts [PMC10045079].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUAAACAUCCUACACUCAGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 56 other species

  1. Alligator mississippiensis ami-miR-30b-5p
  2. Anolis carolinensis (green anole) aca-miR-30b-5p
  3. Bos taurus (cattle) bta-miR-30b-5p
  4. Callithrix jacchus cja-miR-30b
  5. Callorhinchus milii Cmi-Mir-30-P2a_5p (mature (guide))
  6. Canis lupus familiaris (dog) cfa-miR-30b
  7. Capra hircus (goat) chi-miR-30b-5p
  8. Cavia porcellus (domestic guinea pig) cpo-miR-30b-5p
  9. Cervus elaphus (red deer) cel-miR-30b-5p
  10. Chiloscyllium plagiosum microRNA cpl-miR-30b
  11. Chrysemys picta bellii (western painted turtle) Cpi-Mir-30-P2a_5p (mature (guide))
  12. Chrysemys picta (Painted turtle) cpi-miR-30b-5p
  13. Cricetulus griseus (Chinese hamster) cgr-miR-30b-5p
  14. Cyprinus carpio ccr-miR-30b
  15. Danio rerio dre-miR-30b
  16. Dasypus novemcinctus (nine-banded armadillo) dno-miR-30b-5p
  17. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-30-P2a_5p (mature (guide))
  18. Equus caballus eca-miR-30b
  19. Gadus morhua gmo-miR-30c-5p
  20. Gallus gallus (chicken) gga-miR-30b-5p
  21. Gekko japonicus Gja-Mir-30-P2a_5p (mature (guide))
  22. Haplochromis burtoni abu-miR-30d
  23. Homo sapiens hsa-miR-30b-5p
  24. Ictalurus punctatus ipu-miR-30b
  25. Latimeria chalumnae Lch-Mir-30-P2a_5p (mature (guide))
  26. Lepisosteus oculatus Loc-Mir-30-P2a_5p (mature (guide))
  27. Macaca mulatta (Rhesus monkey) Mml-Mir-30-P2a_5p (mature (guide))
  28. Maylandia zebra mze-miR-30d
  29. Microcaecilia unicolor Mun-Mir-30-P2a_5p (mature (guide))
  30. Monodelphis domestica (gray short-tailed opossum) mdo-miR-30b-5p
  31. Monopterus albus (swamp eel) Mal-Mir-30-P2a_5p (mature (guide))
  32. Mus musculus mmu-miR-30b-5p
  33. Neolamprologus brichardi (lyretail cichlid) nbr-miR-30d
  34. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-30b
  35. Ophiophagus hannah (king cobra) oha-miR-30b-5p
  36. Oreochromis niloticus oni-miR-30d
  37. Ornithorhynchus anatinus (platypus) oan-miR-30b-5p
  38. Oryctolagus cuniculus ocu-miR-30b-5p
  39. Otolemur garnettii (small-eared galago) oga-miR-30b
  40. Ovis aries miscellaneous RNA
  41. Pongo pygmaeus (Bornean orangutan) ppy-miR-30b
  42. Pteropus alecto pal-miR-30b-5p
  43. Pundamilia nyererei pny-miR-30d
  44. Python bivittatus (Burmese python) pbv-miR-30b-5p
  45. Salmo salar (Atlantic salmon) ssa-miR-30e-5p
  46. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-30-P2a_5p (mature (guide))
  47. Scyliorhinus torazame Sto-Mir-30-P2a_5p (mature (guide))
  48. Sphenodon punctatus (tuatara) Spt-Mir-30-P2a_5p (mature (guide))
  49. Sus scrofa (pig) ssc-miR-30b-5p
  50. Taeniopygia guttata tgu-miR-30e
  51. Takifugu rubripes (torafugu) fru-miR-30b
  52. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-30b
  53. Tupaia chinensis (Chinese tree shrew) tch-miR-30b-5p
  54. Tursiops truncatus (common bottlenose dolphin) miR-30b-5p
  55. Xenopus laevis xla-miR-30b-5p
  56. Xenopus tropicalis xtr-miR-30b
Publications