Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryctolagus cuniculus (rabbit) ocu-let-7c-5p URS000050DE77_9986

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGGUAGUAGGUUGUAUGGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 66 other species

  1. Alligator mississippiensis (American alligator) ami-let-7c-5p
  2. Anolis carolinensis (green anole) aca-let-7c-5p
  3. Bos taurus (domestic cattle) bta-let-7c
  4. Callithrix jacchus cja-let-7c
  5. Canis lupus familiaris (dog) cfa-let-7c
  6. Capra hircus chi-let-7c-5p
  7. Cavia porcellus (domestic guinea pig) cpo-let-7c-5p
  8. Cervus elaphus cel-let-7c
  9. Chrysemys picta bellii Cpi-Let-7-P1b_5p (mature (guide))
  10. Chrysemys picta cpi-let-7c-5p
  11. Columba livia (rock pigeon) cli-let-7c-5p
  12. Danio rerio dre-let-7c-5p
  13. Daphnia magna Dma-Let-7_5p (mature (guide))
  14. Daphnia pulex (common water flea) Dpu-Let-7_5p (mature (guide))
  15. Dasypus novemcinctus (nine-banded armadillo) dno-let-7c-5p
  16. Daubentonia madagascariensis (aye-aye) dma-let-7c
  17. Echinops telfairi (small Madagascar hedgehog) Ete-Let-7-P1c_5p (mature (guide))
  18. Equus caballus eca-let-7c
  19. Gadus morhua gmo-let-7c-5p
  20. Gallus gallus gga-let-7c-5p
  21. Gekko japonicus Gja-Let-7-P1b_5p (mature (guide))
  22. Gorilla gorilla microRNA let-7c
  23. Haplochromis burtoni abu-let-7c
  24. Hippoglossus hippoglossus (Atlantic halibut) hhi-let-7c
  25. Homo sapiens (human) hsa-let-7c-5p
  26. Hyalella azteca let-7a-5p
  27. Ictalurus punctatus ipu-let-7c
  28. Lagothrix lagotricha microRNA let-7c
  29. Latimeria chalumnae Lch-Let-7-P1c_5p (mature (guide))
  30. Lepisosteus oculatus (spotted gar) Loc-Let-7-P1c_5p (mature (guide))
  31. Limulus polyphemus Lpo-Let-7-P16_5p (mature (guide))
  32. Loxodonta africana (African savanna elephant) Laf-Let-7-P1c_5p (mature (guide))
  33. Macaca mulatta (Rhesus monkey) mml-let-7c-5p
  34. Macaca nemestrina microRNA let-7c
  35. Maylandia zebra mze-let-7c
  36. Microcaecilia unicolor Mun-Let-7-P1c_5p (mature (guide))
  37. Microcebus murinus (gray mouse lemur) mmr-let-7c
  38. Monopterus albus Mal-Let-7-P1c2_5p (mature (guide))
  39. Mus musculus mmu-let-7c-5p
  40. Neolamprologus brichardi (lyretail cichlid) nbr-let-7c
  41. Nomascus leucogenys (northern white-cheeked gibbon) nle-let-7c
  42. Ophiophagus hannah oha-let-7c-5p
  43. Oreochromis niloticus (Nile tilapia) oni-let-7c
  44. Ornithorhynchus anatinus (platypus) oan-let-7c-5p
  45. Otolemur garnettii oga-let-7c
  46. Ovis aries oar-let-7c
  47. Pan paniscus (pygmy chimpanzee) ppa-let-7c
  48. Pan troglodytes (chimpanzee) ptr-let-7c
  49. Papio hamadryas (hamadryas baboon) pha-let-7c
  50. Paralichthys olivaceus pol-let-7a-5p
  51. Pongo abelii (Sumatran orangutan) Pab-Let-7-P1c_5p (mature (guide))
  52. Pongo pygmaeus ppy-let-7c
  53. Pteropus alecto (black flying fox) pal-let-7c-5p
  54. Pundamilia nyererei pny-let-7c
  55. Python bivittatus (Burmese python) pbv-let-7c-5p
  56. Rattus norvegicus (Norway rat) rno-let-7c-5p
  57. Saguinus labiatus (red-chested mustached tamarin) microRNA let-7c
  58. Salmo salar (Atlantic salmon) ssa-let-7c-5p
  59. Sarcophilus harrisii (Tasmanian devil) Sha-Let-7-P1c_5p (mature (guide))
  60. Sphenodon punctatus Spt-Let-7-P1b_5p (mature (guide))
  61. Sus scrofa (pig) ssc-let-7c
  62. Taeniopygia guttata tgu-let-7c-5p
  63. Tor tambroides let-7c-5p
  64. Triops cancriformis tcf-let-7-5p
  65. Xenopus laevis (African clawed frog) xla-let-7c-5p
  66. Xenopus tropicalis xtr-let-7c
Relationships

Molecular Relationships

Publications