Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-let-7c URS000050DE77_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-let-7c: Ssc-let-7c is a member of the let-7 family of microRNAs (miRNAs) that has been found to be down-regulated in GH-secreting pituitary adenomas associated with excessive GH secretion [PMC4489742]. In a study, ssc-let-7c, along with other members of the let-7 family (ssc-let-7a, ssc-let-7f, ssc-miR-143-3p, ssc-miR-10b, ssc-miR148a, ssc-miR127, ssc-miR30d, and ssc-miR181a), were found to be highly expressed in skeletal muscles [PMC3528764]. Another study showed that ssc-let-7c and other miRNAs (ssc-miR30b3p and sscmiR129a3p) potentially regulate IL production and play pivotal roles in IL-mediated signaling pathways triggered by T. gondii infection [PMC8851844]. In a study on adipose tissue-related processes in pigs, it was found that the top 10 most abundant miRNAs included ssclet 7c [PMC7222822]. Additionally, it has been shown that members of the let 7 family (including ssc let 7c) are differentially expressed between PRRSV-infected and mock-infected PAMs [PMC9550049]. Sscl et 7c is also associated with muscle growth regulation in pigs [PMC7435270]. These findings highlight the importance of sscl et 7c in various biological processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGGUAGUAGGUUGUAUGGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 64 other species

  1. Alligator mississippiensis ami-let-7c-5p
  2. Anolis carolinensis (green anole) aca-let-7c-5p
  3. Bos taurus bta-let-7c
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-let-7c
  5. Canis lupus familiaris (dog) cfa-let-7c
  6. Capra hircus (goat) chi-let-7c-5p
  7. Cavia porcellus cpo-let-7c-5p
  8. Cervus elaphus (red deer) cel-let-7c
  9. Chrysemys picta bellii (western painted turtle) Cpi-Let-7-P1b_5p (mature (guide))
  10. Chrysemys picta (Painted turtle) cpi-let-7c-5p
  11. Columba livia cli-let-7c-5p
  12. Danio rerio (zebrafish) dre-let-7c-5p
  13. Daphnia magna Dma-Let-7_5p (mature (guide))
  14. Daphnia pulex (common water flea) Dpu-Let-7_5p (mature (guide))
  15. Dasypus novemcinctus dno-let-7c-5p
  16. Daubentonia madagascariensis dma-let-7c
  17. Echinops telfairi Ete-Let-7-P1c_5p (mature (guide))
  18. Equus caballus eca-let-7c
  19. Gadus morhua gmo-let-7c-5p
  20. Gallus gallus gga-let-7c-5p
  21. Gekko japonicus Gja-Let-7-P1b_5p (mature (guide))
  22. Gorilla gorilla (western gorilla) microRNA let-7c
  23. Haplochromis burtoni abu-let-7c
  24. Hippoglossus hippoglossus hhi-let-7c
  25. Homo sapiens hsa-let-7c-5p
  26. Hyalella azteca let-7a-5p
  27. Ictalurus punctatus (channel catfish) ipu-let-7c
  28. Lagothrix lagotricha (brown woolly monkey) microRNA let-7c
  29. Latimeria chalumnae (coelacanth) Lch-Let-7-P1c_5p (mature (guide))
  30. Lepisosteus oculatus (spotted gar) Loc-Let-7-P1c_5p (mature (guide))
  31. Limulus polyphemus Lpo-Let-7-P16_5p (mature (guide))
  32. Macaca mulatta mml-let-7c-5p
  33. Macaca nemestrina (pig-tailed macaque) microRNA let-7c
  34. Maylandia zebra mze-let-7c
  35. Microcaecilia unicolor Mun-Let-7-P1c_5p (mature (guide))
  36. Microcebus murinus (gray mouse lemur) mmr-let-7c
  37. Monopterus albus (swamp eel) Mal-Let-7-P1c2_5p (mature (guide))
  38. Mus musculus (house mouse) mmu-let-7c-5p
  39. Neolamprologus brichardi (lyretail cichlid) nbr-let-7c
  40. Nomascus leucogenys (northern white-cheeked gibbon) nle-let-7c
  41. Ophiophagus hannah oha-let-7c-5p
  42. Oreochromis niloticus oni-let-7c
  43. Ornithorhynchus anatinus (platypus) oan-let-7c-5p
  44. Oryctolagus cuniculus (rabbit) ocu-let-7c-5p
  45. Otolemur garnettii oga-let-7c
  46. Ovis aries (sheep) oar-let-7c
  47. Pan paniscus ppa-let-7c
  48. Pan troglodytes ptr-let-7c
  49. Papio hamadryas (hamadryas baboon) pha-let-7c
  50. Paralichthys olivaceus pol-let-7a-5p
  51. Pongo pygmaeus (Bornean orangutan) ppy-let-7c
  52. Pteropus alecto pal-let-7c-5p
  53. Pundamilia nyererei pny-let-7c
  54. Python bivittatus (Burmese python) pbv-let-7c-5p
  55. Rattus norvegicus (Norway rat) rno-let-7c-5p
  56. Saguinus labiatus microRNA let-7c
  57. Salmo salar (Atlantic salmon) ssa-let-7c-5p
  58. Sarcophilus harrisii (Tasmanian devil) Sha-Let-7-P1c_5p (mature (guide))
  59. Sphenodon punctatus (tuatara) Spt-Let-7-P1b_5p (mature (guide))
  60. Taeniopygia guttata (zebra finch) tgu-let-7c-5p
  61. Tor tambroides (Thai mahseer) let-7c-5p
  62. Triops cancriformis tcf-let-7-5p
  63. Xenopus laevis (African clawed frog) xla-let-7c-5p
  64. Xenopus tropicalis (tropical clawed frog) xtr-let-7c
Publications