Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-let-7c URS000050DE77_9615

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cfa-let-7c: Cfa-let-7c is a microRNA that has been predicted to target the tuberous sclerosis 1 (TSC1) gene, which encodes hamartin [PMC4490541]. Target prediction analysis by TargetScan indicated that TSC1 is a predicted gene target for cfa-let-7c [PMC4490541]. In a study comparing different stages of disease in dogs, cfa-let-7c was found to be significantly different between Stages B1/B2 and C/D [PMC4490541]. In the same study, cfa-let-7c was shown to have increased expression in Stage B1/B2 or C/D compared to Stage A [PMC4490541]. Another study found that cfa-miR-26a, cfa-miR-200c, cfa-let-7c, cfa-let-7b, and cfa-let 7a were the top five meaningful miRNAs in relation to aging in dogs [PMC10135127]. MiRNA families such as miR200 and Mirlet 7 were significantly up-regulated with testicular RA intervention [PMC4049822]. In metastatic and non-metastatic mammary tumors, ten miRNAs including cfa let 7c were validated and showed significant different expression [PMC7646326]. In dogs with MMVD and cardiac enlargement or congestive heart failure, four miRNAs including cfa let 7c were upregulated while seven others were downregulated compared to normal dogs [PMC4964495]. The expression of six of these miRNAs also significantly differed between dogs with congestive heart failure and those with cardiac enlargement [PMC4964495]. The ten microRNAs selected for validation of microarray results included cfa let 7c[ PMC5678797] . Serum analysis has shown the downregulation of cfa-miR-302d, cfa-miR-380, cfa-miR-874, cfa-miR-582, cfa-miR-490, cfa-miR-329b and cfa-miR-487b and the upregulation of cfa-miR-103, cfa-miR-98, cfa let 7b and 7c [PMC5533140].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGGUAGUAGGUUGUAUGGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 64 other species

  1. Alligator mississippiensis ami-let-7c-5p
  2. Anolis carolinensis (green anole) aca-let-7c-5p
  3. Bos taurus bta-let-7c
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-let-7c
  5. Capra hircus (goat) chi-let-7c-5p
  6. Cavia porcellus cpo-let-7c-5p
  7. Cervus elaphus (red deer) cel-let-7c
  8. Chrysemys picta bellii (western painted turtle) Cpi-Let-7-P1b_5p (mature (guide))
  9. Chrysemys picta (Painted turtle) cpi-let-7c-5p
  10. Columba livia cli-let-7c-5p
  11. Danio rerio (zebrafish) dre-let-7c-5p
  12. Daphnia magna Dma-Let-7_5p (mature (guide))
  13. Daphnia pulex (common water flea) Dpu-Let-7_5p (mature (guide))
  14. Dasypus novemcinctus dno-let-7c-5p
  15. Daubentonia madagascariensis dma-let-7c
  16. Echinops telfairi Ete-Let-7-P1c_5p (mature (guide))
  17. Equus caballus eca-let-7c
  18. Gadus morhua gmo-let-7c-5p
  19. Gallus gallus gga-let-7c-5p
  20. Gekko japonicus Gja-Let-7-P1b_5p (mature (guide))
  21. Gorilla gorilla (western gorilla) microRNA let-7c
  22. Haplochromis burtoni abu-let-7c
  23. Hippoglossus hippoglossus hhi-let-7c
  24. Homo sapiens hsa-let-7c-5p
  25. Hyalella azteca let-7a-5p
  26. Ictalurus punctatus (channel catfish) ipu-let-7c
  27. Lagothrix lagotricha (brown woolly monkey) microRNA let-7c
  28. Latimeria chalumnae (coelacanth) Lch-Let-7-P1c_5p (mature (guide))
  29. Lepisosteus oculatus (spotted gar) Loc-Let-7-P1c_5p (mature (guide))
  30. Limulus polyphemus Lpo-Let-7-P16_5p (mature (guide))
  31. Macaca mulatta mml-let-7c-5p
  32. Macaca nemestrina (pig-tailed macaque) microRNA let-7c
  33. Maylandia zebra mze-let-7c
  34. Microcaecilia unicolor Mun-Let-7-P1c_5p (mature (guide))
  35. Microcebus murinus (gray mouse lemur) mmr-let-7c
  36. Monopterus albus (swamp eel) Mal-Let-7-P1c2_5p (mature (guide))
  37. Mus musculus (house mouse) mmu-let-7c-5p
  38. Neolamprologus brichardi (lyretail cichlid) nbr-let-7c
  39. Nomascus leucogenys (northern white-cheeked gibbon) nle-let-7c
  40. Ophiophagus hannah oha-let-7c-5p
  41. Oreochromis niloticus oni-let-7c
  42. Ornithorhynchus anatinus (platypus) oan-let-7c-5p
  43. Oryctolagus cuniculus (rabbit) ocu-let-7c-5p
  44. Otolemur garnettii oga-let-7c
  45. Ovis aries (sheep) oar-let-7c
  46. Pan paniscus ppa-let-7c
  47. Pan troglodytes ptr-let-7c
  48. Papio hamadryas (hamadryas baboon) pha-let-7c
  49. Paralichthys olivaceus pol-let-7a-5p
  50. Pongo pygmaeus (Bornean orangutan) ppy-let-7c
  51. Pteropus alecto pal-let-7c-5p
  52. Pundamilia nyererei pny-let-7c
  53. Python bivittatus (Burmese python) pbv-let-7c-5p
  54. Rattus norvegicus (Norway rat) rno-let-7c-5p
  55. Saguinus labiatus microRNA let-7c
  56. Salmo salar (Atlantic salmon) ssa-let-7c-5p
  57. Sarcophilus harrisii (Tasmanian devil) Sha-Let-7-P1c_5p (mature (guide))
  58. Sphenodon punctatus (tuatara) Spt-Let-7-P1b_5p (mature (guide))
  59. Sus scrofa (pig) ssc-let-7c
  60. Taeniopygia guttata (zebra finch) tgu-let-7c-5p
  61. Tor tambroides (Thai mahseer) let-7c-5p
  62. Triops cancriformis tcf-let-7-5p
  63. Xenopus laevis (African clawed frog) xla-let-7c-5p
  64. Xenopus tropicalis (tropical clawed frog) xtr-let-7c
Publications