Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryctolagus cuniculus (rabbit) ocu-miR-98-5p URS00004E0808_9986

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGGUAGUAAGUUGUAUUGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 41 other species

  1. Anolis carolinensis (green anole) Aca-Let-7-P2b3_5p (mature (guide))
  2. Ateles geoffroyi age-miR-98
  3. Bos taurus (domestic cattle) bta-miR-98
  4. Callithrix jacchus cja-miR-98
  5. Canis lupus familiaris (dog) cfa-miR-98
  6. Capra hircus chi-miR-98-5p
  7. Cavia porcellus (domestic guinea pig) cpo-miR-98-5p
  8. Cervus elaphus (red deer) cel-miR-98
  9. Cricetulus griseus cgr-miR-98
  10. Dasypus novemcinctus (nine-banded armadillo) dno-miR-98-5p
  11. Daubentonia madagascariensis dma-miR-98
  12. Echinops telfairi Ete-Let-7-P2b3_5p (mature (guide))
  13. Equus caballus eca-miR-98
  14. Gekko japonicus Gja-Let-7-P2b3_5p (mature (guide))
  15. Gorilla gorilla gorilla ggo-miR-98 (MIR98)
  16. Gorilla gorilla (western gorilla) ggo-miR-98
  17. Homo sapiens hsa-miR-98-5p
  18. Loxodonta africana (African savanna elephant) Laf-Let-7-P2b3_5p (mature (guide))
  19. Macaca mulatta mml-miR-98
  20. Microcaecilia unicolor Mun-Let-7-P2b3_5p (mature (guide))
  21. Microcebus murinus mmr-miR-98
  22. Mus musculus (house mouse) mmu-miR-98-5p
  23. Nomascus leucogenys nle-miR-98
  24. Ophiophagus hannah (king cobra) oha-miR-98-5p
  25. Ornithorhynchus anatinus oan-miR-98
  26. Otolemur garnettii (small-eared galago) oga-miR-98
  27. Ovis aries (sheep) miscellaneous RNA
  28. Pan paniscus (pygmy chimpanzee) ppa-miR-98
  29. Pan troglodytes (chimpanzee) ptr-miR-98
  30. Papio hamadryas (hamadryas baboon) pha-miR-98
  31. Pongo abelii (Sumatran orangutan) Pab-Let-7-P2b3_5p (mature (guide))
  32. Pongo pygmaeus (Bornean orangutan) ppy-miR-98
  33. Pteropus alecto pal-miR-98-5p
  34. Python bivittatus (Burmese python) pbv-miR-98-5p
  35. Rattus norvegicus (Norway rat) rno-miR-98-5p
  36. Sphenodon punctatus Spt-Let-7-P2b3_5p (mature (guide))
  37. Sus scrofa ssc-miR-98
  38. Tupaia chinensis tch-miR-98-5p
  39. Tursiops truncatus (common bottlenose dolphin) miR-98
  40. Xenopus laevis xla-miR-98-5p
  41. Xenopus tropicalis xtr-miR-98
Relationships

Molecular Relationships

Publications