Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-98 URS00004E0808_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-98: Ssc-mir-98 is a member of the let-7 family of microRNAs (miRNAs) [PMC9550049]. It has been found to be significantly differentially expressed in various studies. In a study on PRRSV-infected and mock-infected PAMs, the let-7 family, including ssc-mir-98, was found to be differentially expressed [PMC9550049]. In another study on early-stage colorectal neoplasia in APC1311 pigs, ssc-mir-98 was one of the miRNAs associated with this condition [PMC5707088]. The differential expression of ssc-mir-98 was validated by qRT-PCR in this study [PMC5707088]. Furthermore, ssc-mir-98 was found to be significantly elevated in more advanced HG-IEN samples compared to LG-IEN samples [PMC5707088]. In a study on the RBP4 group, ssc-mir-98 was upregulated [PMC8153112]. It has also been predicted that circ_0000576 could act as a sponge for ssc-mir-98 and modulate its target genes involved in muscle growth and development [PMC10099641]. Ssc-mir-98 is part of the let-7 family that contains various miRNAs including known miRNAs such as ssc-miR-145 and novel miRNAs such as novel403_ mature [PMC9453844]. In studies on piPSCs, expression of ssc-miR145 and ssc-mir-98 was downregulated compared to pEFs [PMC4934789]. Additionally, in Bama minipigs, upregulation of members from the let7 family including sccmir 98 has been observed.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGGUAGUAAGUUGUAUUGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 39 other species

  1. Anolis carolinensis (green anole) Aca-Let-7-P2b3_5p (mature (guide))
  2. Ateles geoffroyi age-miR-98
  3. Bos taurus (cattle) bta-miR-98
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-98
  5. Canis lupus familiaris (dog) cfa-miR-98
  6. Capra hircus (goat) chi-miR-98-5p
  7. Cavia porcellus cpo-miR-98-5p
  8. Cervus elaphus cel-miR-98
  9. Cricetulus griseus (Chinese hamster) cgr-miR-98
  10. Dasypus novemcinctus dno-miR-98-5p
  11. Daubentonia madagascariensis dma-miR-98
  12. Echinops telfairi Ete-Let-7-P2b3_5p (mature (guide))
  13. Equus caballus (horse) eca-miR-98
  14. Gekko japonicus Gja-Let-7-P2b3_5p (mature (guide))
  15. Gorilla gorilla gorilla ggo-miR-98 (MIR98)
  16. Gorilla gorilla (western gorilla) ggo-miR-98
  17. Homo sapiens hsa-miR-98-5p
  18. Macaca mulatta (Rhesus monkey) mml-miR-98
  19. Microcaecilia unicolor Mun-Let-7-P2b3_5p (mature (guide))
  20. Microcebus murinus mmr-miR-98
  21. Mus musculus (house mouse) mmu-miR-98-5p
  22. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-98
  23. Ophiophagus hannah oha-miR-98-5p
  24. Ornithorhynchus anatinus oan-miR-98
  25. Oryctolagus cuniculus ocu-miR-98-5p
  26. Otolemur garnettii oga-miR-98
  27. Ovis aries miscellaneous RNA
  28. Pan paniscus (pygmy chimpanzee) ppa-miR-98
  29. Pan troglodytes ptr-miR-98
  30. Papio hamadryas (hamadryas baboon) pha-miR-98
  31. Pongo pygmaeus (Bornean orangutan) ppy-miR-98
  32. Pteropus alecto pal-miR-98-5p
  33. Python bivittatus (Burmese python) pbv-miR-98-5p
  34. Rattus norvegicus rno-miR-98-5p
  35. Sphenodon punctatus (tuatara) Spt-Let-7-P2b3_5p (mature (guide))
  36. Tupaia chinensis tch-miR-98-5p
  37. Tursiops truncatus miR-98
  38. Xenopus laevis xla-miR-98-5p
  39. Xenopus tropicalis (tropical clawed frog) xtr-miR-98
Publications