Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Echinops telfairi (small Madagascar hedgehog) Ete-Let-7-P2b3_5p (mature (guide)) URS00004E0808_9371

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGGUAGUAAGUUGUAUUGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 39 other species

  1. Anolis carolinensis (green anole) Aca-Let-7-P2b3_5p (mature (guide))
  2. Ateles geoffroyi age-miR-98
  3. Bos taurus (cattle) bta-miR-98
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-98
  5. Canis lupus familiaris (dog) cfa-miR-98
  6. Capra hircus (goat) chi-miR-98-5p
  7. Cavia porcellus cpo-miR-98-5p
  8. Cervus elaphus cel-miR-98
  9. Cricetulus griseus (Chinese hamster) cgr-miR-98
  10. Dasypus novemcinctus dno-miR-98-5p
  11. Daubentonia madagascariensis dma-miR-98
  12. Equus caballus (horse) eca-miR-98
  13. Gekko japonicus Gja-Let-7-P2b3_5p (mature (guide))
  14. Gorilla gorilla gorilla ggo-miR-98 (MIR98)
  15. Gorilla gorilla (western gorilla) ggo-miR-98
  16. Homo sapiens hsa-miR-98-5p
  17. Macaca mulatta (Rhesus monkey) mml-miR-98
  18. Microcaecilia unicolor Mun-Let-7-P2b3_5p (mature (guide))
  19. Microcebus murinus mmr-miR-98
  20. Mus musculus (house mouse) mmu-miR-98-5p
  21. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-98
  22. Ophiophagus hannah oha-miR-98-5p
  23. Ornithorhynchus anatinus oan-miR-98
  24. Oryctolagus cuniculus ocu-miR-98-5p
  25. Otolemur garnettii oga-miR-98
  26. Ovis aries miscellaneous RNA
  27. Pan paniscus (pygmy chimpanzee) ppa-miR-98
  28. Pan troglodytes ptr-miR-98
  29. Papio hamadryas (hamadryas baboon) pha-miR-98
  30. Pongo pygmaeus (Bornean orangutan) ppy-miR-98
  31. Pteropus alecto pal-miR-98-5p
  32. Python bivittatus (Burmese python) pbv-miR-98-5p
  33. Rattus norvegicus rno-miR-98-5p
  34. Sphenodon punctatus (tuatara) Spt-Let-7-P2b3_5p (mature (guide))
  35. Sus scrofa ssc-miR-98
  36. Tupaia chinensis tch-miR-98-5p
  37. Tursiops truncatus miR-98
  38. Xenopus laevis xla-miR-98-5p
  39. Xenopus tropicalis (tropical clawed frog) xtr-miR-98