v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-let-7g URS00004AFF8D_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-let-7g: Ssc-let-7g is a highly expressed miRNA in various pig breeds and tissues [PMC7724732] [PMC9532862] [PMC4489742] [PMC6718901] [PMC7222822]. It is a member of the let-7 family, which includes ssc-let-7a, ssc-let-7c, ssc-let-7d, ssc-let-7e, ssc-let-7f, ssc-let-7g, ssc-mir98 and ssc-mir98b [PMC9550049]. Ssc let 7g has been found to play important roles in fat-related processes in adipose tissue [PMC7222822]. It is also differentially expressed between PRRSV-infected and mock-infected PAMs [PMC9550049]. Ssc let 7g has been identified as one of the most abundant miRNAs in various pig breeds and tissues including Tibetan pigs and adipose tissue samples from different pig breeds [PMC9532862] [PMC6718901]. It has also been found to be highly expressed in the anterior pituitary gland of pigs [PMC4489742]. The abundantly expressed miRNAs including SsC let 7g have been found to be involved in various biological processes such as fat metabolism and immune response pathways based on GO and KEGG analysis of their potential targets.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGAGGUAGUAGUUUGUACAGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 42 other species

  1. Alligator mississippiensis ami-let-7g-5p
  2. Anolis carolinensis aca-let-7g
  3. Bos taurus bta-let-7g
  4. Callithrix jacchus cja-let-7g
  5. Canis lupus familiaris cfa-let-7g
  6. Capra hircus chi-let-7g-5p
  7. Cavia porcellus (domestic guinea pig) cpo-let-7g-5p
  8. Cervus elaphus (red deer) cel-let-7g
  9. Chrysemys picta bellii Cpi-Let-7-P2c3_5p (mature (guide))
  10. Chrysemys picta (Painted turtle) cpi-let-7g-5p
  11. Columba livia cli-let-7g-5p
  12. Cricetulus griseus cgr-let-7g-5p
  13. Dasypus novemcinctus (nine-banded armadillo) dno-let-7g-5p
  14. Daubentonia madagascariensis dma-let-7g
  15. Echinops telfairi Ete-Let-7-P2c3_5p (mature (guide))
  16. Equus caballus (horse) eca-let-7g
  17. Gallus gallus Gga-Let-7-P2c3_5p (mature (guide))
  18. Gekko japonicus Gja-Let-7-P2c3_5p (mature (guide))
  19. Homo sapiens hsa-let-7g-5p
  20. Latimeria chalumnae (coelacanth) Lch-Let-7-P2c3_5p (mature (guide))
  21. Macaca mulatta (Rhesus monkey) mml-let-7g-5p
  22. Microcaecilia unicolor Mun-Let-7-P2c3_5p (mature (guide))
  23. Microcebus murinus (gray mouse lemur) mmr-let-7g
  24. Monodelphis domestica Mdo-Let-7-P2c3_5p (mature (guide))
  25. Mus musculus mmu-let-7g-5p
  26. Nomascus leucogenys nle-let-7g
  27. Ophiophagus hannah oha-let-7g-5p
  28. Ornithorhynchus anatinus (platypus) oan-let-7g-5p
  29. Oryctolagus cuniculus ocu-let-7g-5p
  30. Otolemur garnettii oga-let-7g
  31. Pan paniscus (pygmy chimpanzee) ppa-let-7g
  32. Pan troglodytes (chimpanzee) ptr-let-7g
  33. Papio hamadryas (hamadryas baboon) pha-let-7g
  34. Pongo pygmaeus ppy-let-7g
  35. Pteropus alecto (black flying fox) pal-let-7g-5p
  36. Python bivittatus pbv-let-7g-5p
  37. Rattus norvegicus rno-let-7g-5p
  38. Sarcophilus harrisii Sha-Let-7-P2c3_5p (mature (guide))
  39. Sphenodon punctatus Spt-Let-7-P2c3_5p (mature (guide))
  40. Taeniopygia guttata tgu-let-7g-5p
  41. Tupaia chinensis (Chinese tree shrew) tch-let-7g-5p
  42. Xenopus laevis xla-let-7g
 Publications