v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-let-7g URS00004AFF8D_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-let-7g: Bta-let-7g is a microRNA (miRNA) that is highly expressed in various samples and stages of the estrous cycle [PMC4156418] [PMC6107498]. It is one of the dominant expressed miRNAs in the unmated library, along with other miRNAs such as bta-miR-26a, gga-miR-21-5p, and bta-miR-125b [PMC8710055]. Bta-let-7g is also among the highly expressed miRNAs in all follicular stages at both day 3 and day 7 of the estrous cycle [PMC4156418]. It has been used as an internal control and an endogenous control in different studies [PMC3885562] [PMC3164151]. Bta-let-7g has target sites in a novel circular RNA (circRNA) called novel_circ_0006981, along with other miRNAs such as bta-miR-133a, bta-miR-146b, and bta-miR-27b [PMC7230347]. In terms of abundance, bta-miR-21-5p is the most highly expressed miRNA, followed by other miRNAs like bta-miR26a and bta-miR191 [PMC6600136] [PMC5821052].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGAGGUAGUAGUUUGUACAGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 42 other species

  1. Alligator mississippiensis ami-let-7g-5p
  2. Anolis carolinensis aca-let-7g
  3. Callithrix jacchus cja-let-7g
  4. Canis lupus familiaris cfa-let-7g
  5. Capra hircus chi-let-7g-5p
  6. Cavia porcellus (domestic guinea pig) cpo-let-7g-5p
  7. Cervus elaphus (red deer) cel-let-7g
  8. Chrysemys picta bellii Cpi-Let-7-P2c3_5p (mature (guide))
  9. Chrysemys picta (Painted turtle) cpi-let-7g-5p
  10. Columba livia cli-let-7g-5p
  11. Cricetulus griseus cgr-let-7g-5p
  12. Dasypus novemcinctus (nine-banded armadillo) dno-let-7g-5p
  13. Daubentonia madagascariensis dma-let-7g
  14. Echinops telfairi Ete-Let-7-P2c3_5p (mature (guide))
  15. Equus caballus (horse) eca-let-7g
  16. Gallus gallus Gga-Let-7-P2c3_5p (mature (guide))
  17. Gekko japonicus Gja-Let-7-P2c3_5p (mature (guide))
  18. Homo sapiens hsa-let-7g-5p
  19. Latimeria chalumnae (coelacanth) Lch-Let-7-P2c3_5p (mature (guide))
  20. Macaca mulatta (Rhesus monkey) mml-let-7g-5p
  21. Microcaecilia unicolor Mun-Let-7-P2c3_5p (mature (guide))
  22. Microcebus murinus (gray mouse lemur) mmr-let-7g
  23. Monodelphis domestica Mdo-Let-7-P2c3_5p (mature (guide))
  24. Mus musculus mmu-let-7g-5p
  25. Nomascus leucogenys nle-let-7g
  26. Ophiophagus hannah oha-let-7g-5p
  27. Ornithorhynchus anatinus (platypus) oan-let-7g-5p
  28. Oryctolagus cuniculus ocu-let-7g-5p
  29. Otolemur garnettii oga-let-7g
  30. Pan paniscus (pygmy chimpanzee) ppa-let-7g
  31. Pan troglodytes (chimpanzee) ptr-let-7g
  32. Papio hamadryas (hamadryas baboon) pha-let-7g
  33. Pongo pygmaeus ppy-let-7g
  34. Pteropus alecto (black flying fox) pal-let-7g-5p
  35. Python bivittatus pbv-let-7g-5p
  36. Rattus norvegicus rno-let-7g-5p
  37. Sarcophilus harrisii Sha-Let-7-P2c3_5p (mature (guide))
  38. Sphenodon punctatus Spt-Let-7-P2c3_5p (mature (guide))
  39. Sus scrofa ssc-let-7g
  40. Taeniopygia guttata tgu-let-7g-5p
  41. Tupaia chinensis (Chinese tree shrew) tch-let-7g-5p
  42. Xenopus laevis xla-let-7g
 Publications