Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Chrysemys picta bellii (western painted turtle) Cpi-Let-7-P2c3_5p (mature (guide)) URS00004AFF8D_8478

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGGUAGUAGUUUGUACAGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 42 other species

  1. Alligator mississippiensis ami-let-7g-5p
  2. Anolis carolinensis aca-let-7g
  3. Bos taurus bta-let-7g
  4. Callithrix jacchus cja-let-7g
  5. Canis lupus familiaris cfa-let-7g
  6. Capra hircus chi-let-7g-5p
  7. Cavia porcellus (domestic guinea pig) cpo-let-7g-5p
  8. Cervus elaphus (red deer) cel-let-7g
  9. Chrysemys picta (Painted turtle) cpi-let-7g-5p
  10. Columba livia cli-let-7g-5p
  11. Cricetulus griseus cgr-let-7g-5p
  12. Dasypus novemcinctus (nine-banded armadillo) dno-let-7g-5p
  13. Daubentonia madagascariensis dma-let-7g
  14. Echinops telfairi Ete-Let-7-P2c3_5p (mature (guide))
  15. Equus caballus (horse) eca-let-7g
  16. Gallus gallus Gga-Let-7-P2c3_5p (mature (guide))
  17. Gekko japonicus Gja-Let-7-P2c3_5p (mature (guide))
  18. Homo sapiens hsa-let-7g-5p
  19. Latimeria chalumnae (coelacanth) Lch-Let-7-P2c3_5p (mature (guide))
  20. Macaca mulatta (Rhesus monkey) mml-let-7g-5p
  21. Microcaecilia unicolor Mun-Let-7-P2c3_5p (mature (guide))
  22. Microcebus murinus (gray mouse lemur) mmr-let-7g
  23. Monodelphis domestica Mdo-Let-7-P2c3_5p (mature (guide))
  24. Mus musculus mmu-let-7g-5p
  25. Nomascus leucogenys nle-let-7g
  26. Ophiophagus hannah oha-let-7g-5p
  27. Ornithorhynchus anatinus (platypus) oan-let-7g-5p
  28. Oryctolagus cuniculus ocu-let-7g-5p
  29. Otolemur garnettii oga-let-7g
  30. Pan paniscus (pygmy chimpanzee) ppa-let-7g
  31. Pan troglodytes (chimpanzee) ptr-let-7g
  32. Papio hamadryas (hamadryas baboon) pha-let-7g
  33. Pongo pygmaeus ppy-let-7g
  34. Pteropus alecto (black flying fox) pal-let-7g-5p
  35. Python bivittatus pbv-let-7g-5p
  36. Rattus norvegicus rno-let-7g-5p
  37. Sarcophilus harrisii Sha-Let-7-P2c3_5p (mature (guide))
  38. Sphenodon punctatus Spt-Let-7-P2c3_5p (mature (guide))
  39. Sus scrofa ssc-let-7g
  40. Taeniopygia guttata tgu-let-7g-5p
  41. Tupaia chinensis (Chinese tree shrew) tch-let-7g-5p
  42. Xenopus laevis xla-let-7g