Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-15b URS00004AD914_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-15b: Bta-mir-15b is a differentially expressed microRNA (miRNA) that has been studied in various contexts. In a study on lactation in cows, bta-mir-15b was found to be differentially expressed in peak and late lactation, with higher expression levels in late lactation tissue compared to peak lactation [PMC3498112]. In another study on fertility in bulls, bta-mir-15b was found to be higher in the high motility fractions compared to the low motility fractions [PMC9113469]. Bta-mir-15b has also been studied in relation to various diseases. It was found to be upregulated in cows with metritis compared to healthy cows [PMC7832875]. Additionally, bta-mir-15b has been implicated in mastitis disease development and is predicted to target the gene IKBKB, which is involved in the NF-κB signaling pathway [PMC6162677]. Furthermore, bta-mir-15b has been shown to play a role in gut development, immune function, and digestive functions [PMC6162677]. Overall, bta-mir-15b is a miRNA that exhibits differential expression and plays a role in various biological processes and diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGCAGCACAUCAUGGUUUACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 29 other species

  1. Ateles geoffroyi age-miR-15b
  2. Callithrix jacchus cja-miR-15b
  3. Canis lupus familiaris Cfa-Mir-15-P1b_5p (mature (guide))
  4. Capra hircus chi-miR-15b-5p
  5. Cervus elaphus (red deer) cel-miR-15b
  6. Cricetulus griseus cgr-miR-15b-5p
  7. Dasypus novemcinctus (nine-banded armadillo) dno-miR-15b-5p
  8. Echinops telfairi Ete-Mir-15-P1b_5p (mature (guide))
  9. Eptesicus fuscus efu-miR-15
  10. Equus caballus (horse) eca-miR-15b
  11. Gorilla gorilla gorilla ggo-miR-15b (MIR15B)
  12. Gorilla gorilla ggo-miR-15b
  13. Homo sapiens hsa-miR-15b-5p
  14. Lagothrix lagotricha (brown woolly monkey) lla-miR-15b
  15. Macaca mulatta (Rhesus monkey) mml-miR-15b-5p
  16. Macaca nemestrina mne-miR-15b
  17. Mus musculus mmu-miR-15b-5p
  18. Nomascus leucogenys nle-miR-15b
  19. Oryctolagus cuniculus ocu-miR-15b-5p
  20. Otolemur garnettii oga-miR-15b
  21. Ovis aries (sheep) miscellaneous RNA
  22. Pan paniscus (pygmy chimpanzee) ppa-miR-15b
  23. Pan troglodytes (chimpanzee) ptr-miR-15b
  24. Pongo pygmaeus ppy-miR-15b
  25. Pteropus alecto (black flying fox) pal-miR-15b-5p
  26. Rattus norvegicus rno-miR-15b-5p
  27. Sarcophilus harrisii Sha-Mir-15-P1b_5p (mature (guide))
  28. Sus scrofa ssc-miR-15b
  29. Tupaia chinensis (Chinese tree shrew) tch-miR-15b-5p
Publications