Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) Cfa-Mir-15-P1b_5p (mature (guide)) URS00004AD914_9615

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGCAGCACAUCAUGGUUUACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 29 other species

  1. Ateles geoffroyi age-miR-15b
  2. Bos taurus bta-miR-15b
  3. Callithrix jacchus cja-miR-15b
  4. Capra hircus chi-miR-15b-5p
  5. Cervus elaphus (red deer) cel-miR-15b
  6. Cricetulus griseus cgr-miR-15b-5p
  7. Dasypus novemcinctus (nine-banded armadillo) dno-miR-15b-5p
  8. Echinops telfairi Ete-Mir-15-P1b_5p (mature (guide))
  9. Eptesicus fuscus efu-miR-15
  10. Equus caballus (horse) eca-miR-15b
  11. Gorilla gorilla gorilla ggo-miR-15b (MIR15B)
  12. Gorilla gorilla ggo-miR-15b
  13. Homo sapiens hsa-miR-15b-5p
  14. Lagothrix lagotricha (brown woolly monkey) lla-miR-15b
  15. Macaca mulatta (Rhesus monkey) mml-miR-15b-5p
  16. Macaca nemestrina mne-miR-15b
  17. Mus musculus mmu-miR-15b-5p
  18. Nomascus leucogenys nle-miR-15b
  19. Oryctolagus cuniculus ocu-miR-15b-5p
  20. Otolemur garnettii oga-miR-15b
  21. Ovis aries (sheep) miscellaneous RNA
  22. Pan paniscus (pygmy chimpanzee) ppa-miR-15b
  23. Pan troglodytes (chimpanzee) ptr-miR-15b
  24. Pongo pygmaeus ppy-miR-15b
  25. Pteropus alecto (black flying fox) pal-miR-15b-5p
  26. Rattus norvegicus rno-miR-15b-5p
  27. Sarcophilus harrisii Sha-Mir-15-P1b_5p (mature (guide))
  28. Sus scrofa ssc-miR-15b
  29. Tupaia chinensis (Chinese tree shrew) tch-miR-15b-5p