Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-15b URS00004AD914_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-15b: Ssc-mir-15b is a microRNA that has been studied in various contexts. It has been found to be upregulated in E. coli F18-sensitive pigs, as well as in pigs susceptible to E. coli F18 infection [PMC3427155]. It is also expressed in various pig tissues, including the brain, liver, heart, muscle, colon, kidney, lung, spleen, stomach, cervix and fibroblasts [PMC3427155]. In addition to its role in infection susceptibility and tissue expression patterns, ssc-mir-15b has been implicated in the regulation of lipogenesis and the expression of certain genes. It has been reported to have different expressions between lean and obese pig breeds [PMC7552122]. Furthermore, ssc-mir-15b has been predicted to bind to the 3' UTR of the arresting domain containing 3 (ARRDC3) gene [PMC10159129]. The upregulation of ssc-mir-15b may be linked to a low n-6/n-3 PUFA ratio and the production of anti-inflammatory metabolites [PMC10159129]. Additionally, ssc-mir-15b expression can be inhibited by certain compounds such as SFN (sulforaphane) [PMC9179638]. Overall, ssc-mir-15b is a versatile microRNA that plays a role in infection susceptibility, tissue expression patterns, lipogenesis regulation and gene expression regulation.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGCAGCACAUCAUGGUUUACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 29 other species

  1. Ateles geoffroyi age-miR-15b
  2. Bos taurus bta-miR-15b
  3. Callithrix jacchus cja-miR-15b
  4. Canis lupus familiaris Cfa-Mir-15-P1b_5p (mature (guide))
  5. Capra hircus chi-miR-15b-5p
  6. Cervus elaphus (red deer) cel-miR-15b
  7. Cricetulus griseus cgr-miR-15b-5p
  8. Dasypus novemcinctus (nine-banded armadillo) dno-miR-15b-5p
  9. Echinops telfairi Ete-Mir-15-P1b_5p (mature (guide))
  10. Eptesicus fuscus efu-miR-15
  11. Equus caballus (horse) eca-miR-15b
  12. Gorilla gorilla gorilla ggo-miR-15b (MIR15B)
  13. Gorilla gorilla ggo-miR-15b
  14. Homo sapiens hsa-miR-15b-5p
  15. Lagothrix lagotricha (brown woolly monkey) lla-miR-15b
  16. Macaca mulatta (Rhesus monkey) mml-miR-15b-5p
  17. Macaca nemestrina mne-miR-15b
  18. Mus musculus mmu-miR-15b-5p
  19. Nomascus leucogenys nle-miR-15b
  20. Oryctolagus cuniculus ocu-miR-15b-5p
  21. Otolemur garnettii oga-miR-15b
  22. Ovis aries (sheep) miscellaneous RNA
  23. Pan paniscus (pygmy chimpanzee) ppa-miR-15b
  24. Pan troglodytes (chimpanzee) ptr-miR-15b
  25. Pongo pygmaeus ppy-miR-15b
  26. Pteropus alecto (black flying fox) pal-miR-15b-5p
  27. Rattus norvegicus rno-miR-15b-5p
  28. Sarcophilus harrisii Sha-Mir-15-P1b_5p (mature (guide))
  29. Tupaia chinensis (Chinese tree shrew) tch-miR-15b-5p
Publications