Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pongo pygmaeus (Bornean orangutan) ppy-miR-15b URS00004AD914_9600

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGCAGCACAUCAUGGUUUACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 29 other species

  1. Ateles geoffroyi age-miR-15b
  2. Bos taurus bta-miR-15b
  3. Callithrix jacchus cja-miR-15b
  4. Canis lupus familiaris Cfa-Mir-15-P1b_5p (mature (guide))
  5. Capra hircus chi-miR-15b-5p
  6. Cervus elaphus (red deer) cel-miR-15b
  7. Cricetulus griseus cgr-miR-15b-5p
  8. Dasypus novemcinctus (nine-banded armadillo) dno-miR-15b-5p
  9. Echinops telfairi Ete-Mir-15-P1b_5p (mature (guide))
  10. Eptesicus fuscus efu-miR-15
  11. Equus caballus (horse) eca-miR-15b
  12. Gorilla gorilla gorilla ggo-miR-15b (MIR15B)
  13. Gorilla gorilla ggo-miR-15b
  14. Homo sapiens hsa-miR-15b-5p
  15. Lagothrix lagotricha (brown woolly monkey) lla-miR-15b
  16. Macaca mulatta (Rhesus monkey) mml-miR-15b-5p
  17. Macaca nemestrina mne-miR-15b
  18. Mus musculus mmu-miR-15b-5p
  19. Nomascus leucogenys nle-miR-15b
  20. Oryctolagus cuniculus ocu-miR-15b-5p
  21. Otolemur garnettii oga-miR-15b
  22. Ovis aries (sheep) miscellaneous RNA
  23. Pan paniscus (pygmy chimpanzee) ppa-miR-15b
  24. Pan troglodytes (chimpanzee) ptr-miR-15b
  25. Pteropus alecto (black flying fox) pal-miR-15b-5p
  26. Rattus norvegicus rno-miR-15b-5p
  27. Sarcophilus harrisii Sha-Mir-15-P1b_5p (mature (guide))
  28. Sus scrofa ssc-miR-15b
  29. Tupaia chinensis (Chinese tree shrew) tch-miR-15b-5p