Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-33-5p URS0000483184_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-33: Mmu-mir-33 is a specific type of microRNA that has been identified as m7G dependent and is known to be exportin-1-dependent [PMC9411329]. It has been found to bind to SMARCA2 [PMC6391818]. Quantification and quantitative real-time PCR of mmu-mir-33 were performed using SYBR Green Master Mix on an iCycler Real-Time Detection System [PMC4197861]. The primers specific for mmu-mir-33 were used and the values were normalized to SNORD68 as a housekeeping gene [PMC4197861]. Mimic and inhibitor oligonucleotides of mmu-mir-33 were synthesized for experimental purposes [PMC5339503]. The binding site of mmu-mir-33 was identified in the IRS-2 3' untranslated region (3' UTR) [PMC5339503]. Mmu-miR-155, mmu-miR-26, and mmu-mir-33 have been found to play important roles in immune reaction, response, and signal pathway induction [PMC4136864]. It has been suggested that species discrepancy may be responsible for the presence of mmu-miR-1895, mmu-miR-210, and mmu-mir-33 among the identified miRNAs [PMC4136864]. Mmu-mir-33 mimic has been shown to reduce the activity of Atg5 and Lamp1 3'UTR-luciferase reporter in HEK293 cells compared to control mimic treated cells [PMC4873392].

mRNA interactions 6 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGCAUUGUAGUUGCAUUGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 59 other species

  1. Aedes aegypti aae-miR-33
  2. Alligator mississippiensis (American alligator) ami-miR-33-5p
  3. Anolis carolinensis aca-miR-33-5p
  4. Anopheles gambiae aga-miR-33-5p
  5. Blattella germanica (German cockroach) Bge-Mir-33_5p (mature (guide))
  6. Bombyx mori bmo-miR-33-5p
  7. Bos taurus (cattle) bta-miR-33a
  8. Branchiostoma belcheri bbe-miR-33-5p
  9. Branchiostoma floridae (Florida lancelet) Bfl-Mir-33-P6_5p (mature (guide))
  10. Branchiostoma lanceolatum (amphioxus) Bla-Mir-33-P6_5p (mature (guide))
  11. Callorhinchus milii Cmi-Mir-33-P1_5p (mature (guide))
  12. Canis lupus familiaris Cfa-Mir-33-P3_5p (mature (guide))
  13. Capitella teleta cte-miR-33
  14. Cavia porcellus (domestic guinea pig) cpo-miR-33a-5p
  15. Centruroides sculpturatus Csc-Mir-33_5p (mature (guide))
  16. Chrysemys picta bellii Cpi-Mir-33-P1_5p (mature (co-guide))
  17. Chrysemys picta (Painted turtle) cpi-miR-33-5p
  18. Columba livia cli-miR-33-5p
  19. Crassostrea gigas Cgi-Mir-33_5p (mature (guide))
  20. Culex quinquefasciatus cqu-miR-33
  21. Dasypus novemcinctus dno-miR-33a-5p
  22. Dinoponera quadriceps dqu-miR-33-5p
  23. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-33-P3_5p (mature (guide))
  24. Eisenia fetida Efe-Mir-33_5p (mature (co-guide))
  25. Eptatretus burgeri (inshore hagfish) Ebu-Mir-33_5p (mature (guide))
  26. Equus caballus (horse) eca-miR-33a
  27. Gadus morhua gmo-miR-33b-5p
  28. Gallus gallus (chicken) Gga-Mir-33-P3_5p (mature (co-guide))
  29. Gekko japonicus Gja-Mir-33-P1_5p (mature (guide))
  30. Heliconius melpomene Hme-Mir-33-P8_5p (mature (guide))
  31. Homo sapiens hsa-miR-33a-5p
  32. Latimeria chalumnae Lch-Mir-33-P1_5p (mature (guide))
  33. Lepisosteus oculatus (spotted gar) Loc-Mir-33-P1_5p (mature (guide))
  34. Limulus polyphemus (Atlantic horseshoe crab) Lpo-Mir-33-P12_5p (mature (guide))
  35. Lottia gigantea (owl limpet) Lgi-Mir-33_5p (mature (guide))
  36. Macaca mulatta (Rhesus monkey) Mml-Mir-33-P3_5p (mature (guide))
  37. Manduca sexta mse-miR-33
  38. Microcaecilia unicolor Mun-Mir-33-P3_5p (mature (guide))
  39. Monodelphis domestica (gray short-tailed opossum) mdo-miR-33-5p
  40. Monopterus albus (swamp eel) Mal-Mir-33-P1b_5p (mature (co-guide))
  41. Nautilus pompilius Npo-Mir-33_5p (mature (guide))
  42. Oreochromis niloticus oni-miR-33b-5p
  43. Ornithorhynchus anatinus Oan-Mir-33-P1_5p (mature (guide))
  44. Oryctolagus cuniculus (rabbit) ocu-miR-33a-5p
  45. Pteropus alecto (black flying fox) pal-miR-33a-5p
  46. Ptychodera flava Pfl-Mir-33_5p (mature (guide))
  47. Python bivittatus pbv-miR-33-5p
  48. Rattus norvegicus (Norway rat) rno-miR-33-5p
  49. Salmo salar (Atlantic salmon) ssa-miR-33a-5p
  50. Scyliorhinus torazame Sto-Mir-33-P1_5p (mature (guide))
  51. Sphenodon punctatus Spt-Mir-33-P3_5p (mature (guide))
  52. Taeniopygia guttata (zebra finch) Tgu-Mir-33-P1_5p (mature (guide))
  53. Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-33-P1b_5p (mature (guide))
  54. Tribolium castaneum Tca-Mir-33_5p (mature (guide))
  55. Triops cancriformis tcf-miR-33
  56. Tupaia chinensis tch-miR-33a-5p
  57. Xenopus laevis (African clawed frog) xla-miR-33a-5p
  58. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-33-P1_5p (mature (guide))
  59. Xenoturbella bocki Xbo-Mir-33_5p (mature (guide))
Publications