v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-33a-5p URS0000483184_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-33: Hsa-mir-33 is a microRNA that is part of the hsa-mir-33 family, which includes mir-33a and mir-33b. These microRNAs are located within the intronic regions of the protein-coding genes for Sterol regulatory element-binding proteins (SREBP-2 and SREBP-1) [PMC5537262]. Hsa-mir-33 is mapped to 22q13.2 [PMC1361789]. In the context of HIV infection, hsa-mir-33, along with hsa-miR-122-5p and hsa-miR-125a-5p, were identified as the most relevant shared miRNAs [PMC8615810]. Hsa-mir-33 has been shown to regulate lipolysis in adipose tissue, suggesting its potential role in altering the supply of free fatty acids in the local circulation for the heart [PMC9141930]. References: [PMC2650783]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2650783/ [PMC5537262]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5537262/ [PMC1361789]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1361789/ [PMC8615810]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8615810/ [PMC9141930]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9141930/

mRNA interactions 7 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUGCAUUGUAGUUGCAUUGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 59 other species

  1. Aedes aegypti aae-miR-33
  2. Alligator mississippiensis (American alligator) ami-miR-33-5p
  3. Anolis carolinensis aca-miR-33-5p
  4. Anopheles gambiae aga-miR-33-5p
  5. Blattella germanica (German cockroach) Bge-Mir-33_5p (mature (guide))
  6. Bombyx mori bmo-miR-33-5p
  7. Bos taurus (cattle) bta-miR-33a
  8. Branchiostoma belcheri bbe-miR-33-5p
  9. Branchiostoma floridae (Florida lancelet) Bfl-Mir-33-P6_5p (mature (guide))
  10. Branchiostoma lanceolatum (amphioxus) Bla-Mir-33-P6_5p (mature (guide))
  11. Callorhinchus milii Cmi-Mir-33-P1_5p (mature (guide))
  12. Canis lupus familiaris Cfa-Mir-33-P3_5p (mature (guide))
  13. Capitella teleta cte-miR-33
  14. Cavia porcellus (domestic guinea pig) cpo-miR-33a-5p
  15. Centruroides sculpturatus Csc-Mir-33_5p (mature (guide))
  16. Chrysemys picta bellii Cpi-Mir-33-P1_5p (mature (co-guide))
  17. Chrysemys picta (Painted turtle) cpi-miR-33-5p
  18. Columba livia cli-miR-33-5p
  19. Crassostrea gigas Cgi-Mir-33_5p (mature (guide))
  20. Culex quinquefasciatus cqu-miR-33
  21. Dasypus novemcinctus dno-miR-33a-5p
  22. Dinoponera quadriceps dqu-miR-33-5p
  23. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-33-P3_5p (mature (guide))
  24. Eisenia fetida Efe-Mir-33_5p (mature (co-guide))
  25. Eptatretus burgeri (inshore hagfish) Ebu-Mir-33_5p (mature (guide))
  26. Equus caballus (horse) eca-miR-33a
  27. Gadus morhua gmo-miR-33b-5p
  28. Gallus gallus (chicken) Gga-Mir-33-P3_5p (mature (co-guide))
  29. Gekko japonicus Gja-Mir-33-P1_5p (mature (guide))
  30. Heliconius melpomene Hme-Mir-33-P8_5p (mature (guide))
  31. Latimeria chalumnae Lch-Mir-33-P1_5p (mature (guide))
  32. Lepisosteus oculatus (spotted gar) Loc-Mir-33-P1_5p (mature (guide))
  33. Limulus polyphemus (Atlantic horseshoe crab) Lpo-Mir-33-P12_5p (mature (guide))
  34. Lottia gigantea (owl limpet) Lgi-Mir-33_5p (mature (guide))
  35. Macaca mulatta (Rhesus monkey) Mml-Mir-33-P3_5p (mature (guide))
  36. Manduca sexta mse-miR-33
  37. Microcaecilia unicolor Mun-Mir-33-P3_5p (mature (guide))
  38. Monodelphis domestica (gray short-tailed opossum) mdo-miR-33-5p
  39. Monopterus albus (swamp eel) Mal-Mir-33-P1b_5p (mature (co-guide))
  40. Mus musculus (house mouse) mmu-miR-33-5p
  41. Nautilus pompilius Npo-Mir-33_5p (mature (guide))
  42. Oreochromis niloticus oni-miR-33b-5p
  43. Ornithorhynchus anatinus Oan-Mir-33-P1_5p (mature (guide))
  44. Oryctolagus cuniculus (rabbit) ocu-miR-33a-5p
  45. Pteropus alecto (black flying fox) pal-miR-33a-5p
  46. Ptychodera flava Pfl-Mir-33_5p (mature (guide))
  47. Python bivittatus pbv-miR-33-5p
  48. Rattus norvegicus (Norway rat) rno-miR-33-5p
  49. Salmo salar (Atlantic salmon) ssa-miR-33a-5p
  50. Scyliorhinus torazame Sto-Mir-33-P1_5p (mature (guide))
  51. Sphenodon punctatus Spt-Mir-33-P3_5p (mature (guide))
  52. Taeniopygia guttata (zebra finch) Tgu-Mir-33-P1_5p (mature (guide))
  53. Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-33-P1b_5p (mature (guide))
  54. Tribolium castaneum Tca-Mir-33_5p (mature (guide))
  55. Triops cancriformis tcf-miR-33
  56. Tupaia chinensis tch-miR-33a-5p
  57. Xenopus laevis (African clawed frog) xla-miR-33a-5p
  58. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-33-P1_5p (mature (guide))
  59. Xenoturbella bocki Xbo-Mir-33_5p (mature (guide))
 Publications